EMAIL THIS PAGE TO A FRIEND

ASCC1

activating signal cointegrator 1 complex subunit 1

70 Gene Product Result for
Synonyms: ASC1p50 p50
UniProtKB ID: Q8N9N2, Q5SW06, Q5SW07, Q96EI8, Q9Y307
Gene ID:
Human(51008) Summary: This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(69090) activating signal cointegrator 1 complex subunit 1
Rat(294512) activating signal cointegrator 1 complex subunit 1
naked mole-rat(101726495) activating signal cointegrator 1 complex subunit 1
Goat(100861081) activating signal cointegrator 1 complex subunit 1
sheep(101113387) activating signal cointegrator 1 complex subunit 1
Zebrafish(550273) activating signal cointegrator 1 complex subunit 1
cow(534915) activating signal cointegrator 1 complex subunit 1
domestic cat(101081081) activating signal cointegrator 1 complex subunit 1
dog(608331) activating signal cointegrator 1 complex subunit 1
chicken(423709) activating signal cointegrator 1 complex subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015947 Rosetta Predictions human pricing
NM_001007632 Rosetta Predictions rat pricing
NM_026937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181061 predicted 355
2 SASI_Hs01_00181062 predicted 210
3 SASI_Hs01_00181063 predicted 519
4 SASI_Hs02_00348588 predicted 233
5 SASI_Hs01_00181065 predicted 1025
6 SASI_Hs01_00181066 predicted 790
7 SASI_Hs01_00181067 predicted 1111
8 SASI_Hs01_00181068 predicted 246
9 SASI_Hs01_00181069 predicted 1016
10 SASI_Hs01_00181070 predicted 972
11 SASI_Hs01_00181064 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115356 predicted 338
2 SASI_Rn01_00115357 predicted 617
3 SASI_Rn01_00115358 predicted 904
4 SASI_Rn01_00115359 predicted 762
5 SASI_Rn01_00115360 predicted 675
6 SASI_Rn01_00115361 predicted 668
7 SASI_Rn01_00115362 predicted 288
8 SASI_Rn01_00115363 predicted 374
9 SASI_Rn01_00115364 predicted 862
10 SASI_Rn02_00198737 predicted 284
11 SASI_Rn01_00115365 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067569 predicted 926
2 SASI_Mm01_00067570 predicted 330
3 SASI_Mm01_00067571 predicted 694
4 SASI_Mm01_00067572 predicted 694
5 SASI_Mm02_00331231 predicted 686
6 SASI_Mm01_00067573 predicted 775
7 SASI_Mm01_00067575 predicted 357
8 SASI_Mm01_00067576 predicted 570
9 SASI_Mm01_00067577 predicted 631
10 SASI_Mm02_00331232 predicted 393
11 SASI_Mm01_00067574 predicted 934
12 SASI_Mm01_00067578 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015947
VALIDATED
ASCC1 MISSION shRNA Bacterial Glycerol Stock
activating signal cointegrator 1 complex subunit 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015947.2-1561s21c1
Sequence:CCGGTGCACAGTTCAGTAACGTTAACTCGAGTTAACGTTACTGAACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015947.2-216s21c1
Sequence:CCGGAGAATTGATGGCCGGAATTACCTCGAGGTAATTCCGGCCATCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015947.1-840s1c1
Sequence:CCGGCCTCAATGAAGTTGAGGTTCACTCGAGTGAACCTCAACTTCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015947.1-508s1c1
Sequence:CCGGGAAGATGAAGAGGACTTCTATCTCGAGATAGAAGTCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-484s1c1
Sequence:CCGGCAAGAACAGACCTATCAACATCTCGAGATGTTGATAGGTCTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-1221s1c1
Sequence:CCGGGAAAGAGTGGAATAGTGTGAACTCGAGTTCACACTATTCCACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015947.1-1345s1c1
Sequence:CCGGGAATCATTTGATGGCCGAAATCTCGAGATTTCGGCCATCAAATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015947.1-962s1c1
Sequence:CCGGCTATTGGGATGTTGGTGCTTTCTCGAGAAAGCACCAACATCCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-951s1c1
Sequence:CCGGGCTTCATCTAACTATTGGGATCTCGAGATCCCAATAGTTAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015947
VALIDATED
ASCC1 MISSION shRNA shRNA Plasmid DNA
activating signal cointegrator 1 complex subunit 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015947.2-1561s21c1
Sequence:CCGGTGCACAGTTCAGTAACGTTAACTCGAGTTAACGTTACTGAACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015947.2-216s21c1
Sequence:CCGGAGAATTGATGGCCGGAATTACCTCGAGGTAATTCCGGCCATCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015947.1-840s1c1
Sequence:CCGGCCTCAATGAAGTTGAGGTTCACTCGAGTGAACCTCAACTTCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015947.1-508s1c1
Sequence:CCGGGAAGATGAAGAGGACTTCTATCTCGAGATAGAAGTCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-484s1c1
Sequence:CCGGCAAGAACAGACCTATCAACATCTCGAGATGTTGATAGGTCTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-1221s1c1
Sequence:CCGGGAAAGAGTGGAATAGTGTGAACTCGAGTTCACACTATTCCACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015947.1-1345s1c1
Sequence:CCGGGAATCATTTGATGGCCGAAATCTCGAGATTTCGGCCATCAAATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015947.1-962s1c1
Sequence:CCGGCTATTGGGATGTTGGTGCTTTCTCGAGAAAGCACCAACATCCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-951s1c1
Sequence:CCGGGCTTCATCTAACTATTGGGATCTCGAGATCCCAATAGTTAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015947
VALIDATED
ASCC1 MISSION shRNA Lentiviral Transduction Particles
activating signal cointegrator 1 complex subunit 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015947.2-1561s21c1
Sequence:CCGGTGCACAGTTCAGTAACGTTAACTCGAGTTAACGTTACTGAACTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015947.2-216s21c1
Sequence:CCGGAGAATTGATGGCCGGAATTACCTCGAGGTAATTCCGGCCATCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015947.1-840s1c1
Sequence:CCGGCCTCAATGAAGTTGAGGTTCACTCGAGTGAACCTCAACTTCATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015947.1-508s1c1
Sequence:CCGGGAAGATGAAGAGGACTTCTATCTCGAGATAGAAGTCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-484s1c1
Sequence:CCGGCAAGAACAGACCTATCAACATCTCGAGATGTTGATAGGTCTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-1221s1c1
Sequence:CCGGGAAAGAGTGGAATAGTGTGAACTCGAGTTCACACTATTCCACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015947.1-1345s1c1
Sequence:CCGGGAATCATTTGATGGCCGAAATCTCGAGATTTCGGCCATCAAATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015947.1-962s1c1
Sequence:CCGGCTATTGGGATGTTGGTGCTTTCTCGAGAAAGCACCAACATCCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_015947.1-951s1c1
Sequence:CCGGGCTTCATCTAACTATTGGGATCTCGAGATCCCAATAGTTAGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026937
VALIDATED
ASCC1 MISSION shRNA Bacterial Glycerol Stock
activating signal cointegrator 1 complex subunit 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-403s21c1
Sequence:CCGGATCACTGGTCAGCATCGAAATCTCGAGATTTCGATGCTGACCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-1312s21c1
Sequence:CCGGCTTGGCTTCTGTCCTTCATTCCTCGAGGAATGAAGGACAGAAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-175s21c1
Sequence:CCGGCATGAAGAAGACGAGGATTTCCTCGAGGAAATCCTCGTCTTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-682s21c1
Sequence:CCGGGAGATCCTGCAGCGCTGTAAACTCGAGTTTACAGCGCTGCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-121s21c1
Sequence:CCGGACGTTCGATGGACGGAATTATCTCGAGATAATTCCGTCCATCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026937.1-1311s1c1
Sequence:CCGGCCTTGGCTTCTGTCCTTCATTCTCGAGAATGAAGGACAGAAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026937.1-1180s1c1
Sequence:CCGGGAGAACCATGACTGACTGGATCTCGAGATCCAGTCAGTCATGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026937.1-1077s1c1
Sequence:CCGGGAGGCTCAATTCTATTCACATCTCGAGATGTGAATAGAATTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026937
VALIDATED
ASCC1 MISSION shRNA shRNA Plasmid DNA
activating signal cointegrator 1 complex subunit 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-403s21c1
Sequence:CCGGATCACTGGTCAGCATCGAAATCTCGAGATTTCGATGCTGACCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-1312s21c1
Sequence:CCGGCTTGGCTTCTGTCCTTCATTCCTCGAGGAATGAAGGACAGAAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-175s21c1
Sequence:CCGGCATGAAGAAGACGAGGATTTCCTCGAGGAAATCCTCGTCTTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-682s21c1
Sequence:CCGGGAGATCCTGCAGCGCTGTAAACTCGAGTTTACAGCGCTGCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-121s21c1
Sequence:CCGGACGTTCGATGGACGGAATTATCTCGAGATAATTCCGTCCATCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026937.1-1311s1c1
Sequence:CCGGCCTTGGCTTCTGTCCTTCATTCTCGAGAATGAAGGACAGAAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026937.1-1180s1c1
Sequence:CCGGGAGAACCATGACTGACTGGATCTCGAGATCCAGTCAGTCATGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026937.1-1077s1c1
Sequence:CCGGGAGGCTCAATTCTATTCACATCTCGAGATGTGAATAGAATTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026937
VALIDATED
ASCC1 MISSION shRNA Lentiviral Transduction Particles
activating signal cointegrator 1 complex subunit 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-403s21c1
Sequence:CCGGATCACTGGTCAGCATCGAAATCTCGAGATTTCGATGCTGACCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-1312s21c1
Sequence:CCGGCTTGGCTTCTGTCCTTCATTCCTCGAGGAATGAAGGACAGAAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-175s21c1
Sequence:CCGGCATGAAGAAGACGAGGATTTCCTCGAGGAAATCCTCGTCTTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-682s21c1
Sequence:CCGGGAGATCCTGCAGCGCTGTAAACTCGAGTTTACAGCGCTGCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026937.1-121s21c1
Sequence:CCGGACGTTCGATGGACGGAATTATCTCGAGATAATTCCGTCCATCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026937.1-1311s1c1
Sequence:CCGGCCTTGGCTTCTGTCCTTCATTCTCGAGAATGAAGGACAGAAGCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026937.1-1180s1c1
Sequence:CCGGGAGAACCATGACTGACTGGATCTCGAGATCCAGTCAGTCATGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026937.1-1077s1c1
Sequence:CCGGGAGGCTCAATTCTATTCACATCTCGAGATGTGAATAGAATTGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks