EMAIL THIS PAGE TO A FRIEND

ASCC2

activating signal cointegrator 1 complex subunit 2

67 Gene Product Result for
Synonyms: ASC1p100 p100
Gene ID:
Mouse(75452) activating signal cointegrator 1 complex subunit 2
Rat(498402) activating signal cointegrator 1 complex subunit 2
Zebrafish(393414) activating signal cointegrator 1 complex subunit 2
domestic cat(101089048) activating signal cointegrator 1 complex subunit 2
cow(505503) activating signal cointegrator 1 complex subunit 2
Horse(100058860) activating signal cointegrator 1 complex subunit 2
dog(486348) activating signal cointegrator 1 complex subunit 2
chicken(417016) activating signal cointegrator 1 complex subunit 2
sheep(101109043) activating signal cointegrator 1 complex subunit 2
Domestic Rabbit(100358472) activating signal cointegrator 1 complex subunit 2
domestic guinea pig(100714160) activating signal cointegrator 1 complex subunit 2
naked mole-rat(101709238) activating signal cointegrator 1 complex subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032204 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007501 MISSION® esiRNA esiRNA targeting human ASCC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032204 Rosetta Predictions human pricing
NM_001109091 Rosetta Predictions rat pricing
NM_029291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160132 predicted 1116
2 SASI_Hs01_00160133 predicted 535
3 SASI_Hs01_00160135 predicted 962
4 SASI_Hs01_00160136 predicted 1068
5 SASI_Hs01_00160137 predicted 833
6 SASI_Hs01_00160139 predicted 998
7 SASI_Hs01_00160140 predicted 1342
8 SASI_Hs01_00160141 predicted 2041
9 SASI_Hs02_00359496 predicted 1415
10 SASI_Hs02_00359497 predicted 667
11 SASI_Hs01_00160134 predicted 1672
12 SASI_Hs01_00160138 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245040 predicted 927
2 SASI_Rn02_00245041 predicted 1303
3 SASI_Rn02_00245042 predicted 1145
4 SASI_Rn02_00245043 predicted 764
5 SASI_Rn02_00245044 predicted 1552
6 SASI_Rn02_00245045 predicted 789
7 SASI_Rn02_00245046 predicted 1329
8 SASI_Rn02_00245047 predicted 1080
9 SASI_Rn02_00245048 predicted 1099
10 SASI_Rn02_00245049 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126699 predicted 1645
2 SASI_Mm02_00335096 predicted 774
3 SASI_Mm01_00126701 predicted 1441
4 SASI_Mm01_00126703 predicted 764
5 SASI_Mm01_00126704 predicted 1057
6 SASI_Mm01_00126705 predicted 992
7 SASI_Mm01_00126706 predicted 502
8 SASI_Mm01_00126707 predicted 905
9 SASI_Mm01_00126708 predicted 1663
10 SASI_Mm02_00335097 predicted 1082
11 SASI_Mm01_00126700 predicted 753
12 SASI_Mm01_00126702 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029291
VALIDATED
ASCC2 MISSION shRNA Bacterial Glycerol Stock
activating signal cointegrator 1 complex subunit 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029291.1-344s1c1
Sequence:CCGGCCGAAAGTTTGATGAGTGGGTCTCGAGACCCACTCATCAAACTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029291.1-1637s1c1
Sequence:CCGGGTTGTCATCTCGTCACAACATCTCGAGATGTTGTGACGAGATGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-1137s21c1
Sequence:CCGGCTCCGTGACTACGACACATTCCTCGAGGAATGTGTCGTAGTCACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-2374s21c1
Sequence:CCGGGTGAGCGCCTTCTTGTCAAACCTCGAGGTTTGACAAGAAGGCGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-137s21c1
Sequence:CCGGGCAGAAGGCAGACCGGTATTTCTCGAGAAATACCGGTCTGCCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-1855s21c1
Sequence:CCGGATGACTATGAGGACGAGTATGCTCGAGCATACTCGTCCTCATAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029291.1-256s21c1
Sequence:CCGGTGGCCTTGCCTCACGATAAATCTCGAGATTTATCGTGAGGCAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029291
VALIDATED
ASCC2 MISSION shRNA shRNA Plasmid DNA
activating signal cointegrator 1 complex subunit 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029291.1-344s1c1
Sequence:CCGGCCGAAAGTTTGATGAGTGGGTCTCGAGACCCACTCATCAAACTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029291.1-1637s1c1
Sequence:CCGGGTTGTCATCTCGTCACAACATCTCGAGATGTTGTGACGAGATGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-1137s21c1
Sequence:CCGGCTCCGTGACTACGACACATTCCTCGAGGAATGTGTCGTAGTCACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-2374s21c1
Sequence:CCGGGTGAGCGCCTTCTTGTCAAACCTCGAGGTTTGACAAGAAGGCGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-137s21c1
Sequence:CCGGGCAGAAGGCAGACCGGTATTTCTCGAGAAATACCGGTCTGCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-1855s21c1
Sequence:CCGGATGACTATGAGGACGAGTATGCTCGAGCATACTCGTCCTCATAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029291.1-256s21c1
Sequence:CCGGTGGCCTTGCCTCACGATAAATCTCGAGATTTATCGTGAGGCAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029291
VALIDATED
ASCC2 MISSION shRNA Lentiviral Transduction Particles
activating signal cointegrator 1 complex subunit 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029291.1-344s1c1
Sequence:CCGGCCGAAAGTTTGATGAGTGGGTCTCGAGACCCACTCATCAAACTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029291.1-1637s1c1
Sequence:CCGGGTTGTCATCTCGTCACAACATCTCGAGATGTTGTGACGAGATGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-1137s21c1
Sequence:CCGGCTCCGTGACTACGACACATTCCTCGAGGAATGTGTCGTAGTCACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247899    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-2374s21c1
Sequence:CCGGGTGAGCGCCTTCTTGTCAAACCTCGAGGTTTGACAAGAAGGCGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-137s21c1
Sequence:CCGGGCAGAAGGCAGACCGGTATTTCTCGAGAAATACCGGTCTGCCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029291.1-1855s21c1
Sequence:CCGGATGACTATGAGGACGAGTATGCTCGAGCATACTCGTCCTCATAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029291.1-256s21c1
Sequence:CCGGTGGCCTTGCCTCACGATAAATCTCGAGATTTATCGTGAGGCAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032204
ASCC2 MISSION shRNA Bacterial Glycerol Stock
activating signal cointegrator 1 complex subunit 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-982s1c1
Sequence:CCGGGCAATTAAGAAGAGGAGGCTTCTCGAGAAGCCTCCTCTTCTTAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-1953s1c1
Sequence:CCGGCGATGACACATACGATGGCAACTCGAGTTGCCATCGTATGTGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-625s1c1
Sequence:CCGGCCACTGCTCCAGAAGATGATACTCGAGTATCATCTTCTGGAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-1659s1c1
Sequence:CCGGCCGCAACCTAGACAGAGAAATCTCGAGATTTCTCTGTCTAGGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032204.3-954s21c1
Sequence:CCGGCGAAGCAGCAATTCCCGAAATCTCGAGATTTCGGGAATTGCTGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032204.3-2556s1c2
Sequence:CCGGGCAGAACACACAGTGCCTTATCTCGAGATAAGGCACTGTGTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032204.3-855s21c1
Sequence:CCGGTGATACCTGCACCACACTTTGCTCGAGCAAAGTGTGGTGCAGGTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032204
ASCC2 MISSION shRNA shRNA Plasmid DNA
activating signal cointegrator 1 complex subunit 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-982s1c1
Sequence:CCGGGCAATTAAGAAGAGGAGGCTTCTCGAGAAGCCTCCTCTTCTTAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-1953s1c1
Sequence:CCGGCGATGACACATACGATGGCAACTCGAGTTGCCATCGTATGTGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-625s1c1
Sequence:CCGGCCACTGCTCCAGAAGATGATACTCGAGTATCATCTTCTGGAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-1659s1c1
Sequence:CCGGCCGCAACCTAGACAGAGAAATCTCGAGATTTCTCTGTCTAGGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032204.3-954s21c1
Sequence:CCGGCGAAGCAGCAATTCCCGAAATCTCGAGATTTCGGGAATTGCTGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032204.3-2556s1c2
Sequence:CCGGGCAGAACACACAGTGCCTTATCTCGAGATAAGGCACTGTGTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032204.3-855s21c1
Sequence:CCGGTGATACCTGCACCACACTTTGCTCGAGCAAAGTGTGGTGCAGGTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032204
ASCC2 MISSION shRNA Lentiviral Transduction Particles
activating signal cointegrator 1 complex subunit 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-982s1c1
Sequence:CCGGGCAATTAAGAAGAGGAGGCTTCTCGAGAAGCCTCCTCTTCTTAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-1953s1c1
Sequence:CCGGCGATGACACATACGATGGCAACTCGAGTTGCCATCGTATGTGTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-625s1c1
Sequence:CCGGCCACTGCTCCAGAAGATGATACTCGAGTATCATCTTCTGGAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032204.3-1659s1c1
Sequence:CCGGCCGCAACCTAGACAGAGAAATCTCGAGATTTCTCTGTCTAGGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032204.3-954s21c1
Sequence:CCGGCGAAGCAGCAATTCCCGAAATCTCGAGATTTCGGGAATTGCTGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032204.3-2556s1c2
Sequence:CCGGGCAGAACACACAGTGCCTTATCTCGAGATAAGGCACTGTGTGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032204.3-855s21c1
Sequence:CCGGTGATACCTGCACCACACTTTGCTCGAGCAAAGTGTGGTGCAGGTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)