EMAIL THIS PAGE TO A FRIEND

ASCC3

activating signal cointegrator 1 complex subunit 3

152 Gene Product Result for
Synonyms: ASC1p200 DJ467N11.1 HELIC1 RNAH dJ121G13.4 p200
Gene ID:
Mouse(77987) activating signal cointegrator 1 complex subunit 3
Rat(309887) activating signal cointegrator 1 complex subunit 3
naked mole-rat(101710759) activating signal cointegrator 1 complex subunit 3
domestic guinea pig(100732817) activating signal cointegrator 1 complex subunit 3
sheep(101123305) activating signal cointegrator 1 complex subunit 3
Domestic Rabbit(100339241) activating signal cointegrator 1 complex subunit 3
Zebrafish(100332599) activating signal cointegrator 1 complex subunit 3
chicken(421790) activating signal cointegrator 1 complex subunit 3
cow(538416) activating signal cointegrator 1 complex subunit 3
domestic cat(101086653) activating signal cointegrator 1 complex subunit 3
dog(475008) activating signal cointegrator 1 complex subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006828 Rosetta Predictions human pricing
NM_022091 Rosetta Predictions human pricing
NM_001107640 Rosetta Predictions rat pricing
XM_125617 Rosetta Predictions mouse pricing
XM_900193 Rosetta Predictions mouse pricing
XM_909518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205331 predicted 342
2 SASI_Hs01_00205332 predicted 326
3 SASI_Hs01_00205333 predicted 339
4 SASI_Hs01_00205336 predicted 6846
5 SASI_Hs01_00205337 predicted 2971
6 SASI_Hs01_00205339 predicted 3180
7 SASI_Hs02_00342386 predicted 4649
8 SASI_Hs02_00342387 predicted 409
9 SASI_Hs02_00342388 predicted 5534
10 SASI_Hs02_00342389 predicted 5624
11 SASI_Hs01_00205334 predicted 3764
12 SASI_Hs01_00205335 predicted 6775
13 SASI_Hs01_00205338 predicted 5784
14 SASI_Hs01_00205340 predicted 2143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062835 predicted 349
2 SASI_Hs01_00062836 predicted 331
3 SASI_Hs01_00062837 predicted 335
4 SASI_Hs01_00062838 predicted 1113
5 SASI_Hs01_00062840 predicted 406
6 SASI_Hs01_00062841 predicted 400
7 SASI_Hs01_00062842 predicted 371
8 SASI_Hs01_00062843 predicted 1118
9 SASI_Hs02_00355475 predicted 411
10 SASI_Hs02_00355476 predicted 1124
11 SASI_Hs01_00062839 predicted 564
12 SASI_Hs01_00062844 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230825 predicted 7040
2 SASI_Rn02_00230826 predicted 6967
3 SASI_Rn02_00230827 predicted 7034
4 SASI_Rn02_00230828 predicted 7063
5 SASI_Rn02_00230829 predicted 6765
6 SASI_Rn02_00230830 predicted 6704
7 SASI_Rn02_00230831 predicted 6961
8 SASI_Rn02_00230832 predicted 6902
9 SASI_Rn02_00230833 predicted 6788
10 SASI_Rn02_00230834 predicted 7039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205507 predicted 6785
2 SASI_Mm01_00205508 predicted 6791
3 SASI_Mm01_00205509 predicted 6421
4 SASI_Mm01_00205510 predicted 6728
5 SASI_Mm01_00205511 predicted 6275
6 SASI_Mm01_00205512 predicted 6482
7 SASI_Mm01_00205513 predicted 6904
8 SASI_Mm01_00205514 predicted 6415
9 SASI_Mm01_00205515 predicted 6910
10 SASI_Mm01_00205516 predicted 6222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246857 predicted 556
2 SASI_Mm01_00246858 predicted 989
3 SASI_Mm01_00246859 predicted 505
4 SASI_Mm01_00246860 predicted 1182
5 SASI_Mm01_00246861 predicted 959
6 SASI_Mm01_00246862 predicted 350
7 SASI_Mm01_00246863 predicted 624
8 SASI_Mm01_00246864 predicted 1149
9 SASI_Mm01_00246865 predicted 676
10 SASI_Mm01_00246866 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434870 predicted 2587
2 SASI_Mm02_00434871 predicted 504
3 SASI_Mm02_00434872 predicted 5485
4 SASI_Mm02_00434873 predicted 5247
5 SASI_Mm02_00434874 predicted 5720
6 SASI_Mm02_00434875 predicted 3113
7 SASI_Mm02_00434876 predicted 2227
8 SASI_Mm02_00434877 predicted 4972
9 SASI_Mm02_00434878 predicted 5419
10 SASI_Mm02_00434879 predicted 4214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198007
VALIDATED
ASCC3 MISSION shRNA Bacterial Glycerol Stock
activating signal cointegrator 1 complex subunit 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-7228s21c1
Sequence:CCGGTTGTGGTGTGACGGGTTAAATCTCGAGATTTAACCCGTCACACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-5487s21c1
Sequence:CCGGAGATTGCTGGAGGTACAATAACTCGAGTTATTGTACCTCCAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-5724s21c1
Sequence:CCGGGAATTGCCTCCTATTACTATTCTCGAGAATAGTAATAGGAGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-664s21c1
Sequence:CCGGTAATGCCACTAATCGAATTATCTCGAGATAATTCGATTAGTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-1708s21c1
Sequence:CCGGTAGAATCCAGTCTATAGTATTCTCGAGAATACTATAGACTGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198007
VALIDATED
ASCC3 MISSION shRNA shRNA Plasmid DNA
activating signal cointegrator 1 complex subunit 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-7228s21c1
Sequence:CCGGTTGTGGTGTGACGGGTTAAATCTCGAGATTTAACCCGTCACACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-5487s21c1
Sequence:CCGGAGATTGCTGGAGGTACAATAACTCGAGTTATTGTACCTCCAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-5724s21c1
Sequence:CCGGGAATTGCCTCCTATTACTATTCTCGAGAATAGTAATAGGAGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-664s21c1
Sequence:CCGGTAATGCCACTAATCGAATTATCTCGAGATAATTCGATTAGTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-1708s21c1
Sequence:CCGGTAGAATCCAGTCTATAGTATTCTCGAGAATACTATAGACTGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198007
VALIDATED
ASCC3 MISSION shRNA Lentiviral Transduction Particles
activating signal cointegrator 1 complex subunit 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-7228s21c1
Sequence:CCGGTTGTGGTGTGACGGGTTAAATCTCGAGATTTAACCCGTCACACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-5487s21c1
Sequence:CCGGAGATTGCTGGAGGTACAATAACTCGAGTTATTGTACCTCCAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-5724s21c1
Sequence:CCGGGAATTGCCTCCTATTACTATTCTCGAGAATAGTAATAGGAGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-664s21c1
Sequence:CCGGTAATGCCACTAATCGAATTATCTCGAGATAATTCGATTAGTGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198007.2-1708s21c1
Sequence:CCGGTAGAATCCAGTCTATAGTATTCTCGAGAATACTATAGACTGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006828
VALIDATED
ASCC3 MISSION shRNA Bacterial Glycerol Stock
activating signal cointegrator 1 complex subunit 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-6993s21c1
Sequence:CCGGCATCTAGACAAATCGAATTACCTCGAGGTAATTCGATTTGTCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-4441s21c1
Sequence:CCGGCTACTTCAAAGGCGGTATATACTCGAGTATATACCGCCTTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-2134s21c1
Sequence:CCGGCCCAGATTGTAAGGCTCCTTACTCGAGTAAGGAGCCTTACAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-3236s21c1
Sequence:CCGGTGAGGAGCGAACTGGATATTTCTCGAGAAATATCCAGTTCGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-2205s21c1
Sequence:CCGGAGCATAGTTGCCCGTACTTTACTCGAGTAAAGTACGGGCAACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-2644s1c1
Sequence:CCGGCGCATGATAAACTCAGCCATTCTCGAGAATGGCTGAGTTTATCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006828.1-6138s1c1
Sequence:CCGGCCAGTGATAAATGTTGGCATACTCGAGTATGCCAACATTTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-423s1c1
Sequence:CCGGGCAGCTTGTAATGCTACTAATCTCGAGATTAGTAGCATTACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-5201s1c1
Sequence:CCGGCCCAGTAGAATCAAGTTTATTCTCGAGAATAAACTTGATTCTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-1843s1c1
Sequence:CCGGCCCAGATTGTAAGGCTCCTTACTCGAGTAAGGAGCCTTACAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006828
VALIDATED
ASCC3 MISSION shRNA shRNA Plasmid DNA
activating signal cointegrator 1 complex subunit 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-6993s21c1
Sequence:CCGGCATCTAGACAAATCGAATTACCTCGAGGTAATTCGATTTGTCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-4441s21c1
Sequence:CCGGCTACTTCAAAGGCGGTATATACTCGAGTATATACCGCCTTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-2134s21c1
Sequence:CCGGCCCAGATTGTAAGGCTCCTTACTCGAGTAAGGAGCCTTACAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-3236s21c1
Sequence:CCGGTGAGGAGCGAACTGGATATTTCTCGAGAAATATCCAGTTCGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-2205s21c1
Sequence:CCGGAGCATAGTTGCCCGTACTTTACTCGAGTAAAGTACGGGCAACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-2644s1c1
Sequence:CCGGCGCATGATAAACTCAGCCATTCTCGAGAATGGCTGAGTTTATCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006828.1-6138s1c1
Sequence:CCGGCCAGTGATAAATGTTGGCATACTCGAGTATGCCAACATTTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-423s1c1
Sequence:CCGGGCAGCTTGTAATGCTACTAATCTCGAGATTAGTAGCATTACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-5201s1c1
Sequence:CCGGCCCAGTAGAATCAAGTTTATTCTCGAGAATAAACTTGATTCTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-1843s1c1
Sequence:CCGGCCCAGATTGTAAGGCTCCTTACTCGAGTAAGGAGCCTTACAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006828
VALIDATED
ASCC3 MISSION shRNA Lentiviral Transduction Particles
activating signal cointegrator 1 complex subunit 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-6993s21c1
Sequence:CCGGCATCTAGACAAATCGAATTACCTCGAGGTAATTCGATTTGTCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-4441s21c1
Sequence:CCGGCTACTTCAAAGGCGGTATATACTCGAGTATATACCGCCTTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-2134s21c1
Sequence:CCGGCCCAGATTGTAAGGCTCCTTACTCGAGTAAGGAGCCTTACAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-3236s21c1
Sequence:CCGGTGAGGAGCGAACTGGATATTTCTCGAGAAATATCCAGTTCGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006828.2-2205s21c1
Sequence:CCGGAGCATAGTTGCCCGTACTTTACTCGAGTAAAGTACGGGCAACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-2644s1c1
Sequence:CCGGCGCATGATAAACTCAGCCATTCTCGAGAATGGCTGAGTTTATCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006828.1-6138s1c1
Sequence:CCGGCCAGTGATAAATGTTGGCATACTCGAGTATGCCAACATTTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-423s1c1
Sequence:CCGGGCAGCTTGTAATGCTACTAATCTCGAGATTAGTAGCATTACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-5201s1c1
Sequence:CCGGCCCAGTAGAATCAAGTTTATTCTCGAGAATAAACTTGATTCTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006828.1-1843s1c1
Sequence:CCGGCCCAGATTGTAAGGCTCCTTACTCGAGTAAGGAGCCTTACAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks