EMAIL THIS PAGE TO A FRIEND

ASCL1

achaete-scute complex homolog 1 (Drosophila)

73 Gene Product Result for
Synonyms: ASH1 HASH1 MASH1 bHLHa46
UniProtKB ID: P50553, A8K3C4, Q9BQ30
Gene ID:
Human(429) Summary: This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]
Mouse(17172) achaete-scute complex homolog 1 (Drosophila)
Rat(64186) achaete-scute complex homolog 1 (Drosophila)
chicken(386573) achaete-scute complex homolog 1 (Drosophila)
cow(540473) achaete-scute complex homolog 1 (Drosophila)
domestic cat(101081993) achaete-scute complex homolog 1 (Drosophila)
dog(482628) achaete-scute complex homolog 1 (Drosophila)
sheep(101110666) achaete-scute complex homolog 1 (Drosophila)
domestic guinea pig(100734843) achaete-scute complex homolog 1 (Drosophila)
naked mole-rat(101704178) achaete-scute complex homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32356 Anti-ALX4 (AB1) antibody produced in rabbit affinity isolated antibody human, mouse, horse, rat, rabbit, canine
western blot pricing
SAB2108471 Anti-ASCL1 IgG fraction of antiserum guinea pig, canine, rat, bovine, rabbit, mouse, human
immunohistochemistry, western blot pricing
SAB1412009 ANTI-ASCL1 antibody produced in mouse clone 1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412150 ANTI-ASCL1 antibody produced in mouse clone 3D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV32355 Anti-ASCL1 antibody produced in rabbit IgG fraction of antiserum rat, rabbit, bovine, mouse, human, guinea pig, canine
immunohistochemistry, western blot pricing
SAB2103889 Anti-ASCL1 antibody produced in rabbit affinity isolated antibody human, guinea pig, bovine, canine, mouse, rat, zebrafish
western blot pricing
HPA029217 Anti-ASCL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0000429M1 Monoclonal Anti-ASCL1 antibody produced in mouse clone 7E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403577 Monoclonal Anti-ASCL1, (C-terminal) antibody produced in mouse clone 2D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004316 Rosetta Predictions human pricing
NM_022384 Rosetta Predictions rat pricing
XM_579457 Rosetta Predictions rat pricing
NM_008553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337347 predicted 1655
2 SASI_Hs01_00247242 predicted 1722
3 SASI_Hs01_00247244 predicted 1625
4 SASI_Hs02_00337348 predicted 1712
5 SASI_Hs01_00247245 predicted 1644
6 SASI_Hs01_00247241 predicted 940
7 SASI_Hs01_00247243 predicted 1005
8 SASI_Hs01_00247247 predicted 1482
9 SASI_Hs01_00247249 predicted 1570
10 SASI_Hs01_00247250 predicted 1300
11 SASI_Hs01_00247246 predicted 970
12 SASI_Hs01_00247248 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054521 predicted 1202
2 SASI_Rn01_00054522 predicted 1201
3 SASI_Rn01_00054523 predicted 1323
4 SASI_Rn01_00054524 predicted 1204
5 SASI_Rn01_00054525 predicted 1196
6 SASI_Rn01_00054526 predicted 1312
7 SASI_Rn01_00054527 predicted 1178
8 SASI_Rn01_00054528 predicted 1204
9 SASI_Rn01_00054529 predicted 1198
10 SASI_Rn01_00054530 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154456 predicted 1036
2 SASI_Rn01_00154457 predicted 1041
3 SASI_Rn01_00154458 predicted 1159
4 SASI_Rn01_00154459 predicted 1036
5 SASI_Rn01_00154460 predicted 1030
6 SASI_Rn01_00154461 predicted 1147
7 SASI_Rn01_00154462 predicted 1012
8 SASI_Rn01_00154463 predicted 1039
9 SASI_Rn01_00154464 predicted 1042
10 SASI_Rn01_00154465 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145866 predicted 1211
2 SASI_Mm01_00145867 predicted 1001
3 SASI_Mm01_00145868 predicted 1145
4 SASI_Mm01_00145869 predicted 1166
5 SASI_Mm01_00145870 predicted 1134
6 SASI_Mm01_00145871 predicted 1207
7 SASI_Mm01_00145872 predicted 1312
8 SASI_Mm01_00145873 predicted 1209
9 SASI_Mm01_00145874 predicted 1312
10 SASI_Mm01_00145875 predicted 1312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004316
ASCL1 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004316.1-1405s1c1
Sequence:CCGGCTCCAATCATTCACGGAGATACTCGAGTATCTCCGTGAATGATTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-884s1c1
Sequence:CCGGCGGCCAACAAGAAGATGAGTACTCGAGTACTCATCTTCTTGTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-718s1c1
Sequence:CCGGCCCGAACTGATGCGCTGCAAACTCGAGTTTGCAGCGCATCAGTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-1125s1c1
Sequence:CCGGTCTCGACTTCACCAACTGGTTCTCGAGAACCAGTTGGTGAAGTCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-1023s1c1
Sequence:CCGGCAACTACTCCAACGACTTGAACTCGAGTTCAAGTCGTTGGAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-955s21c1
Sequence:CCGGCAACCGCGTCAAGTTGGTCAACTCGAGTTGACCAACTTGACGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1019s21c1
Sequence:CCGGGCCAACAAGAAGATGAGTAAGCTCGAGCTTACTCATCTTCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004316.3-1540s21c1
Sequence:CCGGTCCAATCATTCACGGAGATATCTCGAGATATCTCCGTGAATGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1155s21c1
Sequence:CCGGCCAACTACTCCAACGACTTGACTCGAGTCAAGTCGTTGGAGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1260s21c1
Sequence:CCGGTCGACTTCACCAACTGGTTCTCTCGAGAGAACCAGTTGGTGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004316
ASCL1 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004316.1-1405s1c1
Sequence:CCGGCTCCAATCATTCACGGAGATACTCGAGTATCTCCGTGAATGATTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-884s1c1
Sequence:CCGGCGGCCAACAAGAAGATGAGTACTCGAGTACTCATCTTCTTGTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-718s1c1
Sequence:CCGGCCCGAACTGATGCGCTGCAAACTCGAGTTTGCAGCGCATCAGTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-1125s1c1
Sequence:CCGGTCTCGACTTCACCAACTGGTTCTCGAGAACCAGTTGGTGAAGTCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-1023s1c1
Sequence:CCGGCAACTACTCCAACGACTTGAACTCGAGTTCAAGTCGTTGGAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-955s21c1
Sequence:CCGGCAACCGCGTCAAGTTGGTCAACTCGAGTTGACCAACTTGACGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1019s21c1
Sequence:CCGGGCCAACAAGAAGATGAGTAAGCTCGAGCTTACTCATCTTCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004316.3-1540s21c1
Sequence:CCGGTCCAATCATTCACGGAGATATCTCGAGATATCTCCGTGAATGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1155s21c1
Sequence:CCGGCCAACTACTCCAACGACTTGACTCGAGTCAAGTCGTTGGAGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1260s21c1
Sequence:CCGGTCGACTTCACCAACTGGTTCTCTCGAGAGAACCAGTTGGTGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004316
ASCL1 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004316.1-1405s1c1
Sequence:CCGGCTCCAATCATTCACGGAGATACTCGAGTATCTCCGTGAATGATTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-884s1c1
Sequence:CCGGCGGCCAACAAGAAGATGAGTACTCGAGTACTCATCTTCTTGTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-718s1c1
Sequence:CCGGCCCGAACTGATGCGCTGCAAACTCGAGTTTGCAGCGCATCAGTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-1125s1c1
Sequence:CCGGTCTCGACTTCACCAACTGGTTCTCGAGAACCAGTTGGTGAAGTCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004316.1-1023s1c1
Sequence:CCGGCAACTACTCCAACGACTTGAACTCGAGTTCAAGTCGTTGGAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-955s21c1
Sequence:CCGGCAACCGCGTCAAGTTGGTCAACTCGAGTTGACCAACTTGACGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1019s21c1
Sequence:CCGGGCCAACAAGAAGATGAGTAAGCTCGAGCTTACTCATCTTCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004316.3-1540s21c1
Sequence:CCGGTCCAATCATTCACGGAGATATCTCGAGATATCTCCGTGAATGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1155s21c1
Sequence:CCGGCCAACTACTCCAACGACTTGACTCGAGTCAAGTCGTTGGAGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004316.3-1260s21c1
Sequence:CCGGTCGACTTCACCAACTGGTTCTCTCGAGAGAACCAGTTGGTGAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008553
VALIDATED
ASCL1 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-1368s1c1
Sequence:CCGGCCACGGTCTTTGCTTCTGTTTCTCGAGAAACAGAAGCAAAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-359s1c1
Sequence:CCGGCCGGAACTGATGCGCTGCAAACTCGAGTTTGCAGCGCATCAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-670s1c1
Sequence:CCGGCTCCAACGACTTGAACTCTATCTCGAGATAGAGTTCAAGTCGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008553.2-310s1c1
Sequence:CCGGCGGTCACAAGTCAGCGGCCAACTCGAGTTGGCCGCTGACTTGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008553.2-472s1c1
Sequence:CCGGCAAGTTGGTCAACCTGGGTTTCTCGAGAAACCCAGGTTGACCAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1003s21c1
Sequence:CCGGCGGCCAACAAGAAGATGAGCACTCGAGTGCTCATCTTCTTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1204s21c1
Sequence:CCGGAGGGATCCTACGACCCTCTTACTCGAGTAAGAGGGTCGTAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1246s21c1
Sequence:CCGGTGGACTTTACCAACTGGTTCTCTCGAGAGAACCAGTTGGTAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008553.4-1338s21c1
Sequence:CCGGTTCTCGCCAACGACGTCAAATCTCGAGATTTGACGTCGTTGGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008553
VALIDATED
ASCL1 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-1368s1c1
Sequence:CCGGCCACGGTCTTTGCTTCTGTTTCTCGAGAAACAGAAGCAAAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-359s1c1
Sequence:CCGGCCGGAACTGATGCGCTGCAAACTCGAGTTTGCAGCGCATCAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-670s1c1
Sequence:CCGGCTCCAACGACTTGAACTCTATCTCGAGATAGAGTTCAAGTCGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008553.2-310s1c1
Sequence:CCGGCGGTCACAAGTCAGCGGCCAACTCGAGTTGGCCGCTGACTTGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008553.2-472s1c1
Sequence:CCGGCAAGTTGGTCAACCTGGGTTTCTCGAGAAACCCAGGTTGACCAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1003s21c1
Sequence:CCGGCGGCCAACAAGAAGATGAGCACTCGAGTGCTCATCTTCTTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1204s21c1
Sequence:CCGGAGGGATCCTACGACCCTCTTACTCGAGTAAGAGGGTCGTAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1246s21c1
Sequence:CCGGTGGACTTTACCAACTGGTTCTCTCGAGAGAACCAGTTGGTAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008553.4-1338s21c1
Sequence:CCGGTTCTCGCCAACGACGTCAAATCTCGAGATTTGACGTCGTTGGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008553
VALIDATED
ASCL1 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-1368s1c1
Sequence:CCGGCCACGGTCTTTGCTTCTGTTTCTCGAGAAACAGAAGCAAAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-359s1c1
Sequence:CCGGCCGGAACTGATGCGCTGCAAACTCGAGTTTGCAGCGCATCAGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008553.2-670s1c1
Sequence:CCGGCTCCAACGACTTGAACTCTATCTCGAGATAGAGTTCAAGTCGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008553.2-310s1c1
Sequence:CCGGCGGTCACAAGTCAGCGGCCAACTCGAGTTGGCCGCTGACTTGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008553.2-472s1c1
Sequence:CCGGCAAGTTGGTCAACCTGGGTTTCTCGAGAAACCCAGGTTGACCAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1003s21c1
Sequence:CCGGCGGCCAACAAGAAGATGAGCACTCGAGTGCTCATCTTCTTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1204s21c1
Sequence:CCGGAGGGATCCTACGACCCTCTTACTCGAGTAAGAGGGTCGTAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008553.4-1246s21c1
Sequence:CCGGTGGACTTTACCAACTGGTTCTCTCGAGAGAACCAGTTGGTAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008553.4-1338s21c1
Sequence:CCGGTTCTCGCCAACGACGTCAAATCTCGAGATTTGACGTCGTTGGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks