EMAIL THIS PAGE TO A FRIEND

ASCL2

achaete-scute complex homolog 2 (Drosophila)

86 Gene Product Result for
Synonyms: ASH2 HASH2 MASH2 bHLHa45
UniProtKB ID: Q99929, Q6PEY9, Q9UM68
Gene ID:
Human(430) Summary: This gene is a member of the basic helix-loop-helix (BHLH) family of transcription factors. It activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. Involved in the determination of the neuronal precursors in the peripheral nervous system and the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(17173) achaete-scute complex homolog 2 (Drosophila)
Rat(24209) achaete-scute complex homolog 2 (Drosophila)
chicken(395791) achaete-scute complex homolog 2 (Drosophila)
dog(483666) achaete-scute complex homolog 2 (Drosophila)
cow(664650) achaete-scute complex homolog 2 (Drosophila)
domestic cat(101090467) achaete-scute complex homolog 2 (Drosophila)
naked mole-rat(101723250) achaete-scute complex homolog 2 (Drosophila)
domestic guinea pig(100721144) achaete-scute complex homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36912 Anti-ASCL2 (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, bovine, pig, rat, guinea pig
western blot pricing
AV36913 Anti-ASCL2 (AB2) antibody produced in rabbit IgG fraction of antiserum zebrafish, mouse, pig, rat, human, guinea pig, bovine, canine, rabbit
western blot pricing
SAB1305026 ANTI-ASCL2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB2104130 Anti-ASCL2 antibody produced in rabbit affinity isolated antibody , human, pig, rabbit, mouse, guinea pig, bovine, rat
western blot pricing
SAB2106440 Anti-ASCL2 antibody produced in rabbit affinity isolated antibody guinea pig, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005170 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150161 MISSION® esiRNA esiRNA human ASCL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005170 Rosetta Predictions human pricing
NM_031503 Rosetta Predictions rat pricing
NM_008554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137581 predicted 1575
2 SASI_Hs01_00137582 predicted 1470
3 SASI_Hs01_00137583 predicted 1566
4 SASI_Hs01_00137584 predicted 1162
5 SASI_Hs01_00137587 predicted 1167
6 SASI_Hs01_00137588 predicted 1544
7 SASI_Hs01_00137589 predicted 823
8 SASI_Hs01_00137590 predicted 1379
9 SASI_Hs02_00339118 predicted 1613
10 SASI_Hs02_00339119 predicted 1158
11 SASI_Hs01_00137585 predicted 870
12 SASI_Hs01_00137586 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062313 predicted 1293
2 SASI_Rn01_00062314 predicted 651
3 SASI_Rn02_00264625 predicted 1034
4 SASI_Rn01_00062315 predicted 1290
5 SASI_Rn01_00062316 predicted 1168
6 SASI_Rn01_00062317 predicted 1095
7 SASI_Rn02_00264626 predicted 1287
8 SASI_Rn01_00062318 predicted 291
9 SASI_Rn01_00062319 predicted 1177
10 SASI_Rn01_00062321 predicted 590
11 SASI_Rn01_00062320 predicted 917
12 SASI_Rn01_00062322 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082919 predicted 1362
2 SASI_Mm01_00082920 predicted 1247
3 SASI_Mm01_00082921 predicted 1355
4 SASI_Mm01_00082922 predicted 1249
5 SASI_Mm01_00082923 predicted 1360
6 SASI_Mm01_00082924 predicted 1093
7 SASI_Mm01_00082925 predicted 1228
8 SASI_Mm01_00082926 predicted 1299
9 SASI_Mm01_00082927 predicted 645
10 SASI_Mm01_00082928 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008554
ASCL2 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008554.3-561s21c1
Sequence:CCGGAGACAAGCGTCTCCGGAATTGCTCGAGCAATTCCGGAGACGCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008554.3-1390s21c1
Sequence:CCGGTTAAGCTTGGAGCACAATAAACTCGAGTTTATTGTGCTCCAAGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008554.3-1142s21c1
Sequence:CCGGGAAACCTGGGCCTATGCCTTACTCGAGTAAGGCATAGGCCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-706s1c1
Sequence:CCGGCGCCAACAAGAAGCTGAGTAACTCGAGTTACTCAGCTTCTTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-646s1c1
Sequence:CCGGCCGCGTAAAGCTGGTAAACTTCTCGAGAAGTTTACCAGCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-358s1c1
Sequence:CCGGTGAAGGTGCAAACGTCCACTTCTCGAGAAGTGGACGTTTGCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008554.2-1206s1c1
Sequence:CCGGCGGAATGACATCTTCCATCTTCTCGAGAAGATGGAAGATGTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-448s1c1
Sequence:CCGGGCTGAATGCAAGCTTGATGGACTCGAGTCCATCAAGCTTGCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008554
ASCL2 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008554.3-561s21c1
Sequence:CCGGAGACAAGCGTCTCCGGAATTGCTCGAGCAATTCCGGAGACGCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008554.3-1390s21c1
Sequence:CCGGTTAAGCTTGGAGCACAATAAACTCGAGTTTATTGTGCTCCAAGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008554.3-1142s21c1
Sequence:CCGGGAAACCTGGGCCTATGCCTTACTCGAGTAAGGCATAGGCCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-706s1c1
Sequence:CCGGCGCCAACAAGAAGCTGAGTAACTCGAGTTACTCAGCTTCTTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-646s1c1
Sequence:CCGGCCGCGTAAAGCTGGTAAACTTCTCGAGAAGTTTACCAGCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-358s1c1
Sequence:CCGGTGAAGGTGCAAACGTCCACTTCTCGAGAAGTGGACGTTTGCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008554.2-1206s1c1
Sequence:CCGGCGGAATGACATCTTCCATCTTCTCGAGAAGATGGAAGATGTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-448s1c1
Sequence:CCGGGCTGAATGCAAGCTTGATGGACTCGAGTCCATCAAGCTTGCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008554
ASCL2 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008554.3-561s21c1
Sequence:CCGGAGACAAGCGTCTCCGGAATTGCTCGAGCAATTCCGGAGACGCTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008554.3-1390s21c1
Sequence:CCGGTTAAGCTTGGAGCACAATAAACTCGAGTTTATTGTGCTCCAAGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008554.3-1142s21c1
Sequence:CCGGGAAACCTGGGCCTATGCCTTACTCGAGTAAGGCATAGGCCCAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-706s1c1
Sequence:CCGGCGCCAACAAGAAGCTGAGTAACTCGAGTTACTCAGCTTCTTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-646s1c1
Sequence:CCGGCCGCGTAAAGCTGGTAAACTTCTCGAGAAGTTTACCAGCTTTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-358s1c1
Sequence:CCGGTGAAGGTGCAAACGTCCACTTCTCGAGAAGTGGACGTTTGCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008554.2-1206s1c1
Sequence:CCGGCGGAATGACATCTTCCATCTTCTCGAGAAGATGGAAGATGTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008554.2-448s1c1
Sequence:CCGGGCTGAATGCAAGCTTGATGGACTCGAGTCCATCAAGCTTGCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005170
ASCL2 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005170.2-1197s21c1
Sequence:CCGGTACTGAGCGCCCTCGACCTATCTCGAGATAGGTCGAGGGCGCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005170.2-1574s21c1
Sequence:CCGGTGCTGGCAAACGGAGACCTATCTCGAGATAGGTCTCCGTTTGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005170.2-1159s21c1
Sequence:CCGGAGCGCGAGCTACTCGACTTCTCTCGAGAGAAGTCGAGTAGCTCGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005170.2-1622s1c1
Sequence:CCGGGCGTAATAAAGATGACCTGGACTCGAGTCCAGGTCATCTTTATTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-1169s1c1
Sequence:CCGGACTCGACTTCTCCAGCTGGTTCTCGAGAACCAGCTGGAGAAGTCGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-896s1c1
Sequence:CCGGGCGCTCAGCCGTGGAGTACATCTCGAGATGTACTCCACGGCTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-800s1c1
Sequence:CCGGCAACCGCGTGAAGCTGGTGAACTCGAGTTCACCAGCTTCACGCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005170
ASCL2 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005170.2-1197s21c1
Sequence:CCGGTACTGAGCGCCCTCGACCTATCTCGAGATAGGTCGAGGGCGCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005170.2-1574s21c1
Sequence:CCGGTGCTGGCAAACGGAGACCTATCTCGAGATAGGTCTCCGTTTGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005170.2-1159s21c1
Sequence:CCGGAGCGCGAGCTACTCGACTTCTCTCGAGAGAAGTCGAGTAGCTCGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005170.2-1622s1c1
Sequence:CCGGGCGTAATAAAGATGACCTGGACTCGAGTCCAGGTCATCTTTATTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-1169s1c1
Sequence:CCGGACTCGACTTCTCCAGCTGGTTCTCGAGAACCAGCTGGAGAAGTCGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-896s1c1
Sequence:CCGGGCGCTCAGCCGTGGAGTACATCTCGAGATGTACTCCACGGCTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-800s1c1
Sequence:CCGGCAACCGCGTGAAGCTGGTGAACTCGAGTTCACCAGCTTCACGCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005170
ASCL2 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005170.2-1197s21c1
Sequence:CCGGTACTGAGCGCCCTCGACCTATCTCGAGATAGGTCGAGGGCGCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005170.2-1574s21c1
Sequence:CCGGTGCTGGCAAACGGAGACCTATCTCGAGATAGGTCTCCGTTTGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005170.2-1159s21c1
Sequence:CCGGAGCGCGAGCTACTCGACTTCTCTCGAGAGAAGTCGAGTAGCTCGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005170.2-1622s1c1
Sequence:CCGGGCGTAATAAAGATGACCTGGACTCGAGTCCAGGTCATCTTTATTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-1169s1c1
Sequence:CCGGACTCGACTTCTCCAGCTGGTTCTCGAGAACCAGCTGGAGAAGTCGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-896s1c1
Sequence:CCGGGCGCTCAGCCGTGGAGTACATCTCGAGATGTACTCCACGGCTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005170.2-800s1c1
Sequence:CCGGCAACCGCGTGAAGCTGGTGAACTCGAGTTCACCAGCTTCACGCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks