EMAIL THIS PAGE TO A FRIEND

ASCL3

achaete-scute complex homolog 3 (Drosophila)

45 Gene Product Result for
Synonyms: HASH3 SGN1 bHLHa42
UniProtKB ID: Q9NQ33, Q8WYQ6
Gene ID:
Human(56676) Summary: Basic helix-loop-helix transcription factors, such as ASCL3, are essential for the determination of cell fate and the development and differentiation of numerous tissues (Jonsson et al., 2004 [PubMed 15475265]
Mouse(56787) achaete-scute complex homolog 3 (Drosophila)
Rat(246301) achaete-scute complex homolog 3 (Drosophila)
domestic guinea pig(100728191) achaete-scute complex homolog 3 (Drosophila)
naked mole-rat(101697869) achaete-scute complex homolog 3 (Drosophila)
sheep(101106621) achaete-scute complex homolog 3 (Drosophila)
chicken(423052) achaete-scute complex homolog 3 (Drosophila)
dog(100686513) achaete-scute complex homolog 3 (Drosophila)
cow(786757) achaete-scute complex homolog 3 (Drosophila)
domestic cat(101084903) achaete-scute complex homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136851 MISSION® esiRNA esiRNA human ASCL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020646 Rosetta Predictions human pricing
XM_344947 Rosetta Predictions rat pricing
NM_020051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151799 predicted 306
2 SASI_Hs01_00151800 predicted 360
3 SASI_Hs01_00151801 predicted 365
4 SASI_Hs01_00151802 predicted 366
5 SASI_Hs01_00151803 predicted 327
6 SASI_Hs01_00151804 predicted 287
7 SASI_Hs01_00151805 predicted 227
8 SASI_Hs01_00151806 predicted 416
9 SASI_Hs01_00151807 predicted 287
10 SASI_Hs01_00151808 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397771 predicted 329
2 SASI_Rn02_00397772 predicted 459
3 SASI_Rn02_00397773 predicted 367
4 SASI_Rn02_00397774 predicted 403
5 SASI_Rn02_00397775 predicted 360
6 SASI_Rn02_00397776 predicted 469
7 SASI_Rn02_00397777 predicted 327
8 SASI_Rn02_00397778 predicted 363
9 SASI_Rn02_00397779 predicted 458
10 SASI_Rn02_00397780 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129776 predicted 330
2 SASI_Mm01_00129777 predicted 236
3 SASI_Mm01_00129778 predicted 366
4 SASI_Mm01_00129780 predicted 453
5 SASI_Mm01_00129781 predicted 345
6 SASI_Mm01_00129782 predicted 293
7 SASI_Mm01_00129783 predicted 476
8 SASI_Mm01_00129784 predicted 474
9 SASI_Mm01_00129785 predicted 353
10 SASI_Mm02_00325417 predicted 221
11 SASI_Mm01_00129779 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020646
ASCL3 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 3 (Drosophila)
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000016531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020646.1-468s1c1
Sequence:CCGGAGCTGCGATCAAGTACATTAACTCGAGTTAATGTACTTGATCGCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020646.1-87s1c1
Sequence:CCGGTCTACCTGACAAACTTCCTATCTCGAGATAGGAAGTTTGTCAGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020646.1-446s21c1
Sequence:CCGGTCAGCAAAGTGGAAACCCTCACTCGAGTGAGGGTTTCCACTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020646
ASCL3 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 3 (Drosophila)
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000016531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020646.1-468s1c1
Sequence:CCGGAGCTGCGATCAAGTACATTAACTCGAGTTAATGTACTTGATCGCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020646.1-87s1c1
Sequence:CCGGTCTACCTGACAAACTTCCTATCTCGAGATAGGAAGTTTGTCAGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020646.1-446s21c1
Sequence:CCGGTCAGCAAAGTGGAAACCCTCACTCGAGTGAGGGTTTCCACTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020646
ASCL3 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 3 (Drosophila)
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000016531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020646.1-468s1c1
Sequence:CCGGAGCTGCGATCAAGTACATTAACTCGAGTTAATGTACTTGATCGCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020646.1-87s1c1
Sequence:CCGGTCTACCTGACAAACTTCCTATCTCGAGATAGGAAGTTTGTCAGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020646.1-446s21c1
Sequence:CCGGTCAGCAAAGTGGAAACCCTCACTCGAGTGAGGGTTTCCACTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020051
VALIDATED
ASCL3 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020051.1-366s1c1
Sequence:CCGGGCAACGAGTCAAGTGTGTGAACTCGAGTTCACACACTTGACTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-238s1c1
Sequence:CCGGGACACCCTGATCATGAACAATCTCGAGATTGTTCATGATCAGGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-370s1c1
Sequence:CCGGCGAGTCAAGTGTGTGAACGAACTCGAGTTCGTTCACACACTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-240s1c1
Sequence:CCGGCACCCTGATCATGAACAATTACTCGAGTAATTGTTCATGATCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-497s1c1
Sequence:CCGGCTCTCTTGTACCCGGATGAATCTCGAGATTCATCCGGGTACAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-498s21c1
Sequence:CCGGTCTCTTGTACCCGGATGAATCCTCGAGGATTCATCCGGGTACAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-156s21c1
Sequence:CCGGCATGGTCACTGTCCACCTATGCTCGAGCATAGGTGGACAGTGACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-239s21c1
Sequence:CCGGACACCCTGATCATGAACAATTCTCGAGAATTGTTCATGATCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-460s21c1
Sequence:CCGGCTCAGAGCTGCCATCAAATATCTCGAGATATTTGATGGCAGCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-287s21c1
Sequence:CCGGCCATGCCTTACACCAACTACACTCGAGTGTAGTTGGTGTAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020051
VALIDATED
ASCL3 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020051.1-366s1c1
Sequence:CCGGGCAACGAGTCAAGTGTGTGAACTCGAGTTCACACACTTGACTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-238s1c1
Sequence:CCGGGACACCCTGATCATGAACAATCTCGAGATTGTTCATGATCAGGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-370s1c1
Sequence:CCGGCGAGTCAAGTGTGTGAACGAACTCGAGTTCGTTCACACACTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-240s1c1
Sequence:CCGGCACCCTGATCATGAACAATTACTCGAGTAATTGTTCATGATCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-497s1c1
Sequence:CCGGCTCTCTTGTACCCGGATGAATCTCGAGATTCATCCGGGTACAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-498s21c1
Sequence:CCGGTCTCTTGTACCCGGATGAATCCTCGAGGATTCATCCGGGTACAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-156s21c1
Sequence:CCGGCATGGTCACTGTCCACCTATGCTCGAGCATAGGTGGACAGTGACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-239s21c1
Sequence:CCGGACACCCTGATCATGAACAATTCTCGAGAATTGTTCATGATCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-460s21c1
Sequence:CCGGCTCAGAGCTGCCATCAAATATCTCGAGATATTTGATGGCAGCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-287s21c1
Sequence:CCGGCCATGCCTTACACCAACTACACTCGAGTGTAGTTGGTGTAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020051
VALIDATED
ASCL3 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020051.1-366s1c1
Sequence:CCGGGCAACGAGTCAAGTGTGTGAACTCGAGTTCACACACTTGACTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-238s1c1
Sequence:CCGGGACACCCTGATCATGAACAATCTCGAGATTGTTCATGATCAGGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-370s1c1
Sequence:CCGGCGAGTCAAGTGTGTGAACGAACTCGAGTTCGTTCACACACTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-240s1c1
Sequence:CCGGCACCCTGATCATGAACAATTACTCGAGTAATTGTTCATGATCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020051.1-497s1c1
Sequence:CCGGCTCTCTTGTACCCGGATGAATCTCGAGATTCATCCGGGTACAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-498s21c1
Sequence:CCGGTCTCTTGTACCCGGATGAATCCTCGAGGATTCATCCGGGTACAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-156s21c1
Sequence:CCGGCATGGTCACTGTCCACCTATGCTCGAGCATAGGTGGACAGTGACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-239s21c1
Sequence:CCGGACACCCTGATCATGAACAATTCTCGAGAATTGTTCATGATCAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-460s21c1
Sequence:CCGGCTCAGAGCTGCCATCAAATATCTCGAGATATTTGATGGCAGCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020051.1-287s21c1
Sequence:CCGGCCATGCCTTACACCAACTACACTCGAGTGTAGTTGGTGTAAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks