EMAIL THIS PAGE TO A FRIEND

ASCL4

achaete-scute complex homolog 4 (Drosophila)

64 Gene Product Result for
Synonyms: HASH4 bHLHa44
UniProtKB ID: Q6XD76, Q7RTS2
Gene ID:
Human(121549) Summary: Basic helix-loop-helix transcription factors, such as ASCL4, are essential for the determination of cell fate and the development and differentiation of numerous tissues (Jonsson et al., 2004 [PubMed 15475265]
Mouse(67341) achaete-scute complex homolog 4 (Drosophila)
Rat(299687) achaete-scute complex homolog 4 (Drosophila)
chicken(427912) achaete-scute complex homolog 4 (Drosophila)
dog(610742) achaete-scute complex homolog 4 (Drosophila)
cow(540730) achaete-scute complex homolog 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_986783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_986783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_986783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138901 MISSION® esiRNA esiRNA human ASCL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203436 Rosetta Predictions human pricing
XM_001079398 Rosetta Predictions rat pricing
XM_235013 Rosetta Predictions rat pricing
XM_986783 Rosetta Predictions mouse pricing
XM_988322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153636 predicted 1705
2 SASI_Hs02_00373368 predicted 1836
3 SASI_Hs01_00153637 predicted 1641
4 SASI_Hs01_00153638 predicted 1698
5 SASI_Hs01_00153639 predicted 1417
6 SASI_Hs01_00153640 predicted 1566
7 SASI_Hs01_00153641 predicted 1101
8 SASI_Hs01_00153642 predicted 1144
9 SASI_Hs01_00153644 predicted 1752
10 SASI_Hs01_00153645 predicted 1622
11 SASI_Hs01_00153643 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364244 predicted 199
2 SASI_Rn02_00364245 predicted 207
3 SASI_Rn02_00364246 predicted 195
4 SASI_Rn02_00364247 predicted 200
5 SASI_Rn02_00364248 predicted 209
6 SASI_Rn02_00364249 predicted 255
7 SASI_Rn02_00364250 predicted 12
8 SASI_Rn02_00364251 predicted 361
9 SASI_Rn02_00364252 predicted 350
10 SASI_Rn02_00364253 predicted 84
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388901 predicted 203
2 SASI_Rn02_00388902 predicted 215
3 SASI_Rn02_00388903 predicted 198
4 SASI_Rn02_00388904 predicted 207
5 SASI_Rn02_00388905 predicted 202
6 SASI_Rn02_00388906 predicted 250
7 SASI_Rn02_00388907 predicted 12
8 SASI_Rn02_00388908 predicted 365
9 SASI_Rn02_00388909 predicted 354
10 SASI_Rn02_00388910 predicted 84
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267631 predicted 249
2 SASI_Mm01_00267632 predicted 342
3 SASI_Mm01_00267633 predicted 350
4 SASI_Mm01_00267634 predicted 348
5 SASI_Mm02_00449146 predicted 346
6 SASI_Mm01_00267635 predicted 292
7 SASI_Mm01_00267636 predicted 270
8 SASI_Mm01_00267637 predicted 239
9 SASI_Mm01_00267638 predicted 341
10 SASI_Mm02_00449147 predicted 248
11 SASI_Mm01_00267630 predicted 353
12 SASI_Mm01_00267639 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449615 predicted 260
2 SASI_Mm02_00449616 predicted 355
3 SASI_Mm02_00449617 predicted 363
4 SASI_Mm02_00449618 predicted 357
5 SASI_Mm02_00449619 predicted 358
6 SASI_Mm02_00449620 predicted 295
7 SASI_Mm02_00449621 predicted 280
8 SASI_Mm02_00449622 predicted 256
9 SASI_Mm02_00449623 predicted 353
10 SASI_Mm02_00449624 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203436
ASCL4 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 4 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1745s21c1
Sequence:CCGGCTTAACCAAAGAAGAACTTTACTCGAGTAAAGTTCTTCTTTGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1456s21c1
Sequence:CCGGCATCTTCTCCAGGCCTAAATCCTCGAGGATTTAGGCCTGGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1644s21c1
Sequence:CCGGCCTCATTGTAAATACGATTATCTCGAGATAATCGTATTTACAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1090s1c1
Sequence:CCGGCGCTGCGTGAACGAGGGCTATCTCGAGATAGCCCTCGTTCACGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-861s1c1
Sequence:CCGGGCTGGCCTTGCCATACTCGCTCTCGAGAGCGAGTATGGCAAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1179s1c1
Sequence:CCGGCGCTGCCATCGACTACATCAACTCGAGTTGATGTAGTCGATGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1144s1c1
Sequence:CCGGGCAGACAAGCGCCTCAGCAAACTCGAGTTTGCTGAGGCGCTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1263s1c1
Sequence:CCGGCCAGCGCAGGGCGGAATGCAACTCGAGTTGCATTCCGCCCTGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203436
ASCL4 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 4 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1745s21c1
Sequence:CCGGCTTAACCAAAGAAGAACTTTACTCGAGTAAAGTTCTTCTTTGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1456s21c1
Sequence:CCGGCATCTTCTCCAGGCCTAAATCCTCGAGGATTTAGGCCTGGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1644s21c1
Sequence:CCGGCCTCATTGTAAATACGATTATCTCGAGATAATCGTATTTACAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1090s1c1
Sequence:CCGGCGCTGCGTGAACGAGGGCTATCTCGAGATAGCCCTCGTTCACGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-861s1c1
Sequence:CCGGGCTGGCCTTGCCATACTCGCTCTCGAGAGCGAGTATGGCAAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1179s1c1
Sequence:CCGGCGCTGCCATCGACTACATCAACTCGAGTTGATGTAGTCGATGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1144s1c1
Sequence:CCGGGCAGACAAGCGCCTCAGCAAACTCGAGTTTGCTGAGGCGCTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1263s1c1
Sequence:CCGGCCAGCGCAGGGCGGAATGCAACTCGAGTTGCATTCCGCCCTGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203436
ASCL4 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 4 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1745s21c1
Sequence:CCGGCTTAACCAAAGAAGAACTTTACTCGAGTAAAGTTCTTCTTTGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1456s21c1
Sequence:CCGGCATCTTCTCCAGGCCTAAATCCTCGAGGATTTAGGCCTGGAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203436.2-1644s21c1
Sequence:CCGGCCTCATTGTAAATACGATTATCTCGAGATAATCGTATTTACAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1090s1c1
Sequence:CCGGCGCTGCGTGAACGAGGGCTATCTCGAGATAGCCCTCGTTCACGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-861s1c1
Sequence:CCGGGCTGGCCTTGCCATACTCGCTCTCGAGAGCGAGTATGGCAAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1179s1c1
Sequence:CCGGCGCTGCCATCGACTACATCAACTCGAGTTGATGTAGTCGATGGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1144s1c1
Sequence:CCGGGCAGACAAGCGCCTCAGCAAACTCGAGTTTGCTGAGGCGCTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203436.1-1263s1c1
Sequence:CCGGCCAGCGCAGGGCGGAATGCAACTCGAGTTGCATTCCGCCCTGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_986783
ASCL4 MISSION shRNA Bacterial Glycerol Stock
achaete-scute complex homolog 4 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_986783.2-689s21c1
Sequence:CCGGGGAAACTCAATTCTCGTATTTCTCGAGAAATACGAGAATTGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-470s21c1
Sequence:CCGGAGCGTAGCTAGCAGCATCCTACTCGAGTAGGATGCTGCTAGCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-358s21c1
Sequence:CCGGATCAGCTACATCAAGCAACTGCTCGAGCAGTTGCTTGATGTAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-413s21c1
Sequence:CCGGACAGCGATGGCGAGTCCAAAGCTCGAGCTTTGGACTCGCCATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_986783
ASCL4 MISSION shRNA shRNA Plasmid DNA
achaete-scute complex homolog 4 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_986783.2-689s21c1
Sequence:CCGGGGAAACTCAATTCTCGTATTTCTCGAGAAATACGAGAATTGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-470s21c1
Sequence:CCGGAGCGTAGCTAGCAGCATCCTACTCGAGTAGGATGCTGCTAGCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-358s21c1
Sequence:CCGGATCAGCTACATCAAGCAACTGCTCGAGCAGTTGCTTGATGTAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-413s21c1
Sequence:CCGGACAGCGATGGCGAGTCCAAAGCTCGAGCTTTGGACTCGCCATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_986783
ASCL4 MISSION shRNA Lentiviral Transduction Particles
achaete-scute complex homolog 4 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_986783.2-689s21c1
Sequence:CCGGGGAAACTCAATTCTCGTATTTCTCGAGAAATACGAGAATTGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-470s21c1
Sequence:CCGGAGCGTAGCTAGCAGCATCCTACTCGAGTAGGATGCTGCTAGCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-358s21c1
Sequence:CCGGATCAGCTACATCAAGCAACTGCTCGAGCAGTTGCTTGATGTAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_986783.2-413s21c1
Sequence:CCGGACAGCGATGGCGAGTCCAAAGCTCGAGCTTTGGACTCGCCATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks