EMAIL THIS PAGE TO A FRIEND

ASF1A

anti-silencing function 1A histone chaperone

Synonyms: CGI-98 CIA HSPC146
UniProtKB ID: Q9Y294, Q6IA08, Q9P014
Gene ID:
Human(25842) Summary: This gene encodes a member of the H3/H4 family of histone chaperone proteins and is similar to the anti-silencing function-1 gene in yeast. The protein is a key component of a histone donor complex that functions in nucleosome assembly. It interacts with histones H3 and H4, and functions together with a chromatin assembly factor during DNA replication and repair. [provided by RefSeq, Jul 2008]
Mouse(66403) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
Rat(294408) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
chicken(723780) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
domestic cat(101098225) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
cow(618099) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
dog(476273) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
naked mole-rat(101698557) anti-silencing function 1A histone chaperone
sheep(100307033) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
Domestic Rabbit(100328718) ASF1 anti-silencing function 1 homolog A (S. cerevisiae)
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014034 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014034 Rosetta Predictions human pricing
XM_001059946 Rosetta Predictions rat pricing
XM_215389 Rosetta Predictions rat pricing
NM_025541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345019 predicted 540
2 SASI_Hs01_00095726 predicted 1035
3 SASI_Hs02_00345020 predicted 462
4 SASI_Hs01_00095728 predicted 826
5 SASI_Hs02_00345021 predicted 613
6 SASI_Hs02_00345022 predicted 548
7 SASI_Hs02_00345023 predicted 1034
8 SASI_Hs01_00095732 predicted 861
9 SASI_Hs02_00345024 predicted 754
10 SASI_Hs02_00345025 predicted 949
11 SASI_Hs01_00095724 predicted 1217
12 SASI_Hs01_00095725 predicted 1106
13 SASI_Hs01_00095727 predicted 856
14 SASI_Hs01_00095729 predicted 1178
15 SASI_Hs01_00095730 predicted 1148
16 SASI_Hs01_00095731 predicted 1025
17 SASI_Hs01_00095733 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294907 predicted 987
2 SASI_Rn02_00294908 predicted 439
3 SASI_Rn02_00294909 predicted 456
4 SASI_Rn02_00294910 predicted 563
5 SASI_Rn02_00294911 predicted 1111
6 SASI_Rn02_00294912 predicted 1067
7 SASI_Rn02_00294913 predicted 308
8 SASI_Rn02_00294914 predicted 978
9 SASI_Rn02_00294915 predicted 413
10 SASI_Rn02_00294916 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375945 predicted 992
2 SASI_Rn02_00375946 predicted 439
3 SASI_Rn02_00375947 predicted 456
4 SASI_Rn02_00375948 predicted 560
5 SASI_Rn02_00375949 predicted 1114
6 SASI_Rn02_00375950 predicted 1069
7 SASI_Rn02_00375951 predicted 305
8 SASI_Rn02_00375952 predicted 983
9 SASI_Rn02_00375953 predicted 405
10 SASI_Rn02_00375954 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036135 predicted 354
2 SASI_Mm01_00036136 predicted 644
3 SASI_Mm01_00036137 predicted 721
4 SASI_Mm01_00036138 predicted 323
5 SASI_Mm01_00036139 predicted 751
6 SASI_Mm01_00036140 predicted 431
7 SASI_Mm02_00328475 predicted 500
8 SASI_Mm01_00036142 predicted 573
9 SASI_Mm01_00036143 predicted 300
10 SASI_Mm01_00036144 predicted 622
11 SASI_Mm01_00036141 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025541
VALIDATED
ASF1A MISSION shRNA Bacterial Glycerol Stock
anti-silencing function 1A histone chaperone
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-471s1c1
Sequence:CCGGCCTACCGAGGTCAAGAATTTACTCGAGTAAATTCTTGACCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025541.2-474s1c1
Sequence:CCGGACCGAGGTCAAGAATTTATTACTCGAGTAATAAATTCTTGACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-675s1c1
Sequence:CCGGCAAATCTACAGTCCCTTCTTTCTCGAGAAAGAAGGGACTGTAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-674s1c1
Sequence:CCGGCCAAATCTACAGTCCCTTCTTCTCGAGAAGAAGGGACTGTAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025541.2-1533s1c1
Sequence:CCGGCCGAACTTACAAGGGTAATTTCTCGAGAAATTACCCTTGTAAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025541
VALIDATED
ASF1A MISSION shRNA shRNA Plasmid DNA
anti-silencing function 1A histone chaperone
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-471s1c1
Sequence:CCGGCCTACCGAGGTCAAGAATTTACTCGAGTAAATTCTTGACCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025541.2-474s1c1
Sequence:CCGGACCGAGGTCAAGAATTTATTACTCGAGTAATAAATTCTTGACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-675s1c1
Sequence:CCGGCAAATCTACAGTCCCTTCTTTCTCGAGAAAGAAGGGACTGTAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-674s1c1
Sequence:CCGGCCAAATCTACAGTCCCTTCTTCTCGAGAAGAAGGGACTGTAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025541.2-1533s1c1
Sequence:CCGGCCGAACTTACAAGGGTAATTTCTCGAGAAATTACCCTTGTAAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025541
VALIDATED
ASF1A MISSION shRNA Lentiviral Transduction Particles
anti-silencing function 1A histone chaperone
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-471s1c1
Sequence:CCGGCCTACCGAGGTCAAGAATTTACTCGAGTAAATTCTTGACCTCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025541.2-474s1c1
Sequence:CCGGACCGAGGTCAAGAATTTATTACTCGAGTAATAAATTCTTGACCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-675s1c1
Sequence:CCGGCAAATCTACAGTCCCTTCTTTCTCGAGAAAGAAGGGACTGTAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025541.2-674s1c1
Sequence:CCGGCCAAATCTACAGTCCCTTCTTCTCGAGAAGAAGGGACTGTAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025541.2-1533s1c1
Sequence:CCGGCCGAACTTACAAGGGTAATTTCTCGAGAAATTACCCTTGTAAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014034
VALIDATED
ASF1A MISSION shRNA Bacterial Glycerol Stock
anti-silencing function 1A histone chaperone
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014034.1-2173s1c1
Sequence:CCGGGCCAGATGTTAAACTTTGAATCTCGAGATTCAAAGTTTAACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-462s1c1
Sequence:CCGGAGGCGTAACTGTTGTGCTAATCTCGAGATTAGCACAACAGTTACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-424s1c1
Sequence:CCGGGCACCTAATCCAGGACTCATTCTCGAGAATGAGTCCTGGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-341s1c1
Sequence:CCGGGTGAAGAATACGATCAAGTTTCTCGAGAAACTTGATCGTATTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-694s1c1
Sequence:CCGGCCAAATCTACAGTCACTTCTTCTCGAGAAGAAGTGACTGTAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014034.2-1944s21c1
Sequence:CCGGAGAATGAGATCAGGCATATTTCTCGAGAAATATGCCTGATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-608s21c1
Sequence:CCGGGGCGTAACTGTTGTGCTAATTCTCGAGAATTAGCACAACAGTTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-735s21c1
Sequence:CCGGCTAAGCTTCAAAGGAATATTTCTCGAGAAATATTCCTTTGAAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-654s21c1
Sequence:CCGGTTATTAGAGTTGGCTATTATGCTCGAGCATAATAGCCAACTCTAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-558s21c1
Sequence:CCGGTTCAGGCTGATGCACCTAATCCTCGAGGATTAGGTGCATCAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014034
VALIDATED
ASF1A MISSION shRNA shRNA Plasmid DNA
anti-silencing function 1A histone chaperone
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014034.1-2173s1c1
Sequence:CCGGGCCAGATGTTAAACTTTGAATCTCGAGATTCAAAGTTTAACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-462s1c1
Sequence:CCGGAGGCGTAACTGTTGTGCTAATCTCGAGATTAGCACAACAGTTACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-424s1c1
Sequence:CCGGGCACCTAATCCAGGACTCATTCTCGAGAATGAGTCCTGGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-341s1c1
Sequence:CCGGGTGAAGAATACGATCAAGTTTCTCGAGAAACTTGATCGTATTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-694s1c1
Sequence:CCGGCCAAATCTACAGTCACTTCTTCTCGAGAAGAAGTGACTGTAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014034.2-1944s21c1
Sequence:CCGGAGAATGAGATCAGGCATATTTCTCGAGAAATATGCCTGATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-608s21c1
Sequence:CCGGGGCGTAACTGTTGTGCTAATTCTCGAGAATTAGCACAACAGTTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-735s21c1
Sequence:CCGGCTAAGCTTCAAAGGAATATTTCTCGAGAAATATTCCTTTGAAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-654s21c1
Sequence:CCGGTTATTAGAGTTGGCTATTATGCTCGAGCATAATAGCCAACTCTAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-558s21c1
Sequence:CCGGTTCAGGCTGATGCACCTAATCCTCGAGGATTAGGTGCATCAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014034
VALIDATED
ASF1A MISSION shRNA Lentiviral Transduction Particles
anti-silencing function 1A histone chaperone
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014034.1-2173s1c1
Sequence:CCGGGCCAGATGTTAAACTTTGAATCTCGAGATTCAAAGTTTAACATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-462s1c1
Sequence:CCGGAGGCGTAACTGTTGTGCTAATCTCGAGATTAGCACAACAGTTACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-424s1c1
Sequence:CCGGGCACCTAATCCAGGACTCATTCTCGAGAATGAGTCCTGGATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-341s1c1
Sequence:CCGGGTGAAGAATACGATCAAGTTTCTCGAGAAACTTGATCGTATTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014034.1-694s1c1
Sequence:CCGGCCAAATCTACAGTCACTTCTTCTCGAGAAGAAGTGACTGTAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014034.2-1944s21c1
Sequence:CCGGAGAATGAGATCAGGCATATTTCTCGAGAAATATGCCTGATCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-608s21c1
Sequence:CCGGGGCGTAACTGTTGTGCTAATTCTCGAGAATTAGCACAACAGTTACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-735s21c1
Sequence:CCGGCTAAGCTTCAAAGGAATATTTCTCGAGAAATATTCCTTTGAAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-654s21c1
Sequence:CCGGTTATTAGAGTTGGCTATTATGCTCGAGCATAATAGCCAACTCTAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014034.2-558s21c1
Sequence:CCGGTTCAGGCTGATGCACCTAATCCTCGAGGATTAGGTGCATCAGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks