EMAIL THIS PAGE TO A FRIEND

ASF1B

anti-silencing function 1B histone chaperone

Synonyms: CIA-II
UniProtKB ID: Q9NVP2, Q53G51, Q9NVZ0
Gene ID:
Human(55723) Summary: This gene encodes a member of the H3/H4 family of histone chaperone proteins and is similar to the anti-silencing function-1 gene in yeast. The encoded protein is the substrate of the tousled-like kinase family of cell cycle-regulated kinases, and may play a key role in modulating the nucleosome structure of chromatin by ensuring a constant supply of histones at sites of nucleosome assembly. [provided by RefSeq, Jul 2008]
Mouse(66929) ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
Rat(304648) ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
sheep(101123293) ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
domestic guinea pig(100736157) anti-silencing function 1B histone chaperone
naked mole-rat(101707852) anti-silencing function 1B histone chaperone
Thale Cress(833791) histone chaperone ASF1B
cow(510538) ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
domestic cat(101090922) ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
dog(484905) ASF1 anti-silencing function 1 homolog B (S. cerevisiae)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018154 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018154 Rosetta Predictions human pricing
NM_001107160 Rosetta Predictions rat pricing
NM_024184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113327 predicted 1056
2 SASI_Hs01_00113328 predicted 370
3 SASI_Hs01_00113329 predicted 579
4 SASI_Hs01_00113330 predicted 986
5 SASI_Hs01_00113331 predicted 972
6 SASI_Hs01_00113332 predicted 1250
7 SASI_Hs02_00351389 predicted 688
8 SASI_Hs01_00113333 predicted 614
9 SASI_Hs01_00113334 predicted 871
10 SASI_Hs01_00113335 predicted 550
11 SASI_Hs01_00113336 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226095 predicted 610
2 SASI_Rn02_00226096 predicted 228
3 SASI_Rn02_00226097 predicted 842
4 SASI_Rn02_00226098 predicted 364
5 SASI_Rn02_00226099 predicted 771
6 SASI_Rn02_00226100 predicted 315
7 SASI_Rn02_00226101 predicted 1134
8 SASI_Rn02_00226102 predicted 473
9 SASI_Rn02_00226103 predicted 407
10 SASI_Rn02_00226104 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084155 predicted 573
2 SASI_Mm02_00327507 predicted 334
3 SASI_Mm01_00084156 predicted 1191
4 SASI_Mm01_00084157 predicted 978
5 SASI_Mm01_00084158 predicted 284
6 SASI_Mm01_00084159 predicted 198
7 SASI_Mm01_00084160 predicted 656
8 SASI_Mm01_00084161 predicted 1068
9 SASI_Mm01_00084162 predicted 1241
10 SASI_Mm01_00084163 predicted 1167
11 SASI_Mm01_00084164 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018154
VALIDATED
ASF1B MISSION shRNA Bacterial Glycerol Stock
anti-silencing function 1B histone chaperone
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-459s21c1
Sequence:GTACCGGTCATCACCTGCACCTACCATGCTCGAGCATGGTAGGTGCAGGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018154.2-284s21c1
Sequence:CCGGCTGGAGTGGAAGATCATTTATCTCGAGATAAATGATCTTCCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-369s21c1
Sequence:CCGGCAGCAGGGAGACACATGTTTGCTCGAGCAAACATGTGTCTCCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018154.2-1247s21c1
Sequence:CCGGTTAGTTAGTAGGTAGACTTAGCTCGAGCTAAGTCTACCTACTAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-762s21c1
Sequence:CCGGACTCCATGGACTGCATCTAACCTCGAGGTTAGATGCAGTCCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-311s21c1
Sequence:CCGGTCGGCTGAGAGTGAGGAATTTCTCGAGAAATTCCTCACTCTCAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-697s21c1
Sequence:GTACCGGACTCAACTGCACTCCTATCAACTCGAGTTGATAGGAGTGCAGTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-608s21c1
Sequence:GTACCGGGTGACCCGCTTCCATATCAACCTCGAGGTTGATATGGAAGCGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-495s21c1
Sequence:GTACCGGGAGTGGGCTACTACGTCAACACTCGAGTGTTGACGTAGTAGCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-278s1c1
Sequence:CCGGGAGTGGAAGATCATTTATGTTCTCGAGAACATAAATGATCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-487s1c1
Sequence:CCGGAGTGGGCTACTACGTCAACAACTCGAGTTGTTGACGTAGTAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-685s1c1
Sequence:CCGGCCCACTCAACTGCACTCCTATCTCGAGATAGGAGTGCAGTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018154
VALIDATED
ASF1B MISSION shRNA shRNA Plasmid DNA
anti-silencing function 1B histone chaperone
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-459s21c1
Sequence:GTACCGGTCATCACCTGCACCTACCATGCTCGAGCATGGTAGGTGCAGGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018154.2-284s21c1
Sequence:CCGGCTGGAGTGGAAGATCATTTATCTCGAGATAAATGATCTTCCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-369s21c1
Sequence:CCGGCAGCAGGGAGACACATGTTTGCTCGAGCAAACATGTGTCTCCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018154.2-1247s21c1
Sequence:CCGGTTAGTTAGTAGGTAGACTTAGCTCGAGCTAAGTCTACCTACTAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-762s21c1
Sequence:CCGGACTCCATGGACTGCATCTAACCTCGAGGTTAGATGCAGTCCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-311s21c1
Sequence:CCGGTCGGCTGAGAGTGAGGAATTTCTCGAGAAATTCCTCACTCTCAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-697s21c1
Sequence:GTACCGGACTCAACTGCACTCCTATCAACTCGAGTTGATAGGAGTGCAGTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-608s21c1
Sequence:GTACCGGGTGACCCGCTTCCATATCAACCTCGAGGTTGATATGGAAGCGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-495s21c1
Sequence:GTACCGGGAGTGGGCTACTACGTCAACACTCGAGTGTTGACGTAGTAGCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-278s1c1
Sequence:CCGGGAGTGGAAGATCATTTATGTTCTCGAGAACATAAATGATCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-487s1c1
Sequence:CCGGAGTGGGCTACTACGTCAACAACTCGAGTTGTTGACGTAGTAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-685s1c1
Sequence:CCGGCCCACTCAACTGCACTCCTATCTCGAGATAGGAGTGCAGTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018154
VALIDATED
ASF1B MISSION shRNA Lentiviral Transduction Particles
anti-silencing function 1B histone chaperone
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-459s21c1
Sequence:GTACCGGTCATCACCTGCACCTACCATGCTCGAGCATGGTAGGTGCAGGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018154.2-284s21c1
Sequence:CCGGCTGGAGTGGAAGATCATTTATCTCGAGATAAATGATCTTCCACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-369s21c1
Sequence:CCGGCAGCAGGGAGACACATGTTTGCTCGAGCAAACATGTGTCTCCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018154.2-1247s21c1
Sequence:CCGGTTAGTTAGTAGGTAGACTTAGCTCGAGCTAAGTCTACCTACTAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-762s21c1
Sequence:CCGGACTCCATGGACTGCATCTAACCTCGAGGTTAGATGCAGTCCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-311s21c1
Sequence:CCGGTCGGCTGAGAGTGAGGAATTTCTCGAGAAATTCCTCACTCTCAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-697s21c1
Sequence:GTACCGGACTCAACTGCACTCCTATCAACTCGAGTTGATAGGAGTGCAGTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-608s21c1
Sequence:GTACCGGGTGACCCGCTTCCATATCAACCTCGAGGTTGATATGGAAGCGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018154.2-495s21c1
Sequence:GTACCGGGAGTGGGCTACTACGTCAACACTCGAGTGTTGACGTAGTAGCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-278s1c1
Sequence:CCGGGAGTGGAAGATCATTTATGTTCTCGAGAACATAAATGATCTTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-487s1c1
Sequence:CCGGAGTGGGCTACTACGTCAACAACTCGAGTTGTTGACGTAGTAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018154.1-685s1c1
Sequence:CCGGCCCACTCAACTGCACTCCTATCTCGAGATAGGAGTGCAGTTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024184
VALIDATED
ASF1B MISSION shRNA Bacterial Glycerol Stock
anti-silencing function 1B histone chaperone
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024184.1-1155s1c1
Sequence:CCGGCCAGCTCAATACAATGGCTATCTCGAGATAGCCATTGTATTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-246s1c1
Sequence:CCGGCCTGGAGTGGAAGATCATTTACTCGAGTAAATGATCTTCCACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-660s1c1
Sequence:CCGGCCTCAGTTGCACTCCTGTTAACTCGAGTTAACAGGAGTGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-459s1c1
Sequence:CCGGTGTGGGCTACTATGTCAACAACTCGAGTTGTTGACATAGTAGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024184.1-460s1c1
Sequence:CCGGGTGGGCTACTATGTCAACAATCTCGAGATTGTTGACATAGTAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024184
VALIDATED
ASF1B MISSION shRNA shRNA Plasmid DNA
anti-silencing function 1B histone chaperone
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024184.1-1155s1c1
Sequence:CCGGCCAGCTCAATACAATGGCTATCTCGAGATAGCCATTGTATTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-246s1c1
Sequence:CCGGCCTGGAGTGGAAGATCATTTACTCGAGTAAATGATCTTCCACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-660s1c1
Sequence:CCGGCCTCAGTTGCACTCCTGTTAACTCGAGTTAACAGGAGTGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-459s1c1
Sequence:CCGGTGTGGGCTACTATGTCAACAACTCGAGTTGTTGACATAGTAGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024184.1-460s1c1
Sequence:CCGGGTGGGCTACTATGTCAACAATCTCGAGATTGTTGACATAGTAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024184
VALIDATED
ASF1B MISSION shRNA Lentiviral Transduction Particles
anti-silencing function 1B histone chaperone
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024184.1-1155s1c1
Sequence:CCGGCCAGCTCAATACAATGGCTATCTCGAGATAGCCATTGTATTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-246s1c1
Sequence:CCGGCCTGGAGTGGAAGATCATTTACTCGAGTAAATGATCTTCCACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-660s1c1
Sequence:CCGGCCTCAGTTGCACTCCTGTTAACTCGAGTTAACAGGAGTGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024184.1-459s1c1
Sequence:CCGGTGTGGGCTACTATGTCAACAACTCGAGTTGTTGACATAGTAGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024184.1-460s1c1
Sequence:CCGGGTGGGCTACTATGTCAACAATCTCGAGATTGTTGACATAGTAGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks