EMAIL THIS PAGE TO A FRIEND

ASGR1

asialoglycoprotein receptor 1

51 Gene Product Result for
Synonyms: ASGPR ASGPR1 CLEC4H1 HL-1
UniProtKB ID: P07306, I3L1X1
Gene ID:
Human(432) Summary: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(11889) asialoglycoprotein receptor 1
Rat(24210) asialoglycoprotein receptor 1
dog(489461) asialoglycoprotein receptor 1
cow(509121) asialoglycoprotein receptor 1
naked mole-rat(101707146) asialoglycoprotein receptor 1
domestic guinea pig(100714188) asialoglycoprotein receptor 1
sheep(101116157) asialoglycoprotein receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001671 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001671 Rosetta Predictions human pricing
NM_012503 Rosetta Predictions rat pricing
NM_009714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332306 predicted 414
2 SASI_Hs02_00332307 predicted 423
3 SASI_Hs01_00200263 predicted 570
4 SASI_Hs01_00200264 predicted 1082
5 SASI_Hs01_00200265 predicted 836
6 SASI_Hs01_00200266 predicted 625
7 SASI_Hs01_00200267 predicted 1010
8 SASI_Hs01_00200268 predicted 445
9 SASI_Hs01_00200269 predicted 660
10 SASI_Hs01_00200271 predicted 1088
11 SASI_Hs01_00200270 predicted 523
12 SASI_Hs01_00200272 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094621 predicted 219
2 SASI_Rn01_00094622 predicted 439
3 SASI_Rn01_00094623 predicted 829
4 SASI_Rn01_00094624 predicted 497
5 SASI_Rn01_00094625 predicted 218
6 SASI_Rn01_00094626 predicted 422
7 SASI_Rn01_00094627 predicted 519
8 SASI_Rn01_00094628 predicted 760
9 SASI_Rn02_00259556 predicted 254
10 SASI_Rn01_00094629 predicted 420
11 SASI_Rn01_00094630 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051877 predicted 295
2 SASI_Mm01_00051878 predicted 520
3 SASI_Mm01_00051879 predicted 362
4 SASI_Mm01_00051880 predicted 759
5 SASI_Mm01_00051881 predicted 593
6 SASI_Mm01_00051882 predicted 965
7 SASI_Mm01_00051883 predicted 333
8 SASI_Mm01_00051884 predicted 903
9 SASI_Mm02_00316862 predicted 285
10 SASI_Mm01_00051886 predicted 499
11 SASI_Mm01_00051885 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001671
ASGR1 MISSION shRNA Bacterial Glycerol Stock
asialoglycoprotein receptor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-785s1c1
Sequence:CCGGGCACCACATAGGCCCTGTGAACTCGAGTTCACAGGGCCTATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-227s1c1
Sequence:CCGGTGACCACCATCAGCTCAGAAACTCGAGTTTCTGAGCTGATGGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-335s1c1
Sequence:CCGGGCTTGTGGTTGTCTGTGTGATCTCGAGATCACACAGACAACCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-395s1c1
Sequence:CCGGCCTGAGAGAGACGTTCAGCAACTCGAGTTGCTGAACGTCTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-516s1c1
Sequence:CCGGCAGAAGGACCTGAGTGAAGATCTCGAGATCTTCACTCAGGTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001671.3-787s21c1
Sequence:CCGGACGTGAAGCAGTTCGTGTCTGCTCGAGCAGACACGAACTGCTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001671.3-1093s21c1
Sequence:CCGGACTACGAGACGGGCTTCAAGACTCGAGTCTTGAAGCCCGTCTCGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001671
ASGR1 MISSION shRNA shRNA Plasmid DNA
asialoglycoprotein receptor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-785s1c1
Sequence:CCGGGCACCACATAGGCCCTGTGAACTCGAGTTCACAGGGCCTATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-227s1c1
Sequence:CCGGTGACCACCATCAGCTCAGAAACTCGAGTTTCTGAGCTGATGGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-335s1c1
Sequence:CCGGGCTTGTGGTTGTCTGTGTGATCTCGAGATCACACAGACAACCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-395s1c1
Sequence:CCGGCCTGAGAGAGACGTTCAGCAACTCGAGTTGCTGAACGTCTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-516s1c1
Sequence:CCGGCAGAAGGACCTGAGTGAAGATCTCGAGATCTTCACTCAGGTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001671.3-787s21c1
Sequence:CCGGACGTGAAGCAGTTCGTGTCTGCTCGAGCAGACACGAACTGCTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001671.3-1093s21c1
Sequence:CCGGACTACGAGACGGGCTTCAAGACTCGAGTCTTGAAGCCCGTCTCGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001671
ASGR1 MISSION shRNA Lentiviral Transduction Particles
asialoglycoprotein receptor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-785s1c1
Sequence:CCGGGCACCACATAGGCCCTGTGAACTCGAGTTCACAGGGCCTATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-227s1c1
Sequence:CCGGTGACCACCATCAGCTCAGAAACTCGAGTTTCTGAGCTGATGGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-335s1c1
Sequence:CCGGGCTTGTGGTTGTCTGTGTGATCTCGAGATCACACAGACAACCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-395s1c1
Sequence:CCGGCCTGAGAGAGACGTTCAGCAACTCGAGTTGCTGAACGTCTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001671.2-516s1c1
Sequence:CCGGCAGAAGGACCTGAGTGAAGATCTCGAGATCTTCACTCAGGTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001671.3-787s21c1
Sequence:CCGGACGTGAAGCAGTTCGTGTCTGCTCGAGCAGACACGAACTGCTTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001671.3-1093s21c1
Sequence:CCGGACTACGAGACGGGCTTCAAGACTCGAGTCTTGAAGCCCGTCTCGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009714
VALIDATED
ASGR1 MISSION shRNA Bacterial Glycerol Stock
asialoglycoprotein receptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009714.1-1137s1c1
Sequence:CCGGGAACTGGTAGAGCCTACCTAACTCGAGTTAGGTAGGCTCTACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-262s1c1
Sequence:CCGGGACAATGATAATGACCATCATCTCGAGATGATGGTCATTATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-517s1c1
Sequence:CCGGGTGGGAAGAAAGATGAAGTTACTCGAGTAACTTCATCTTTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-1053s1c1
Sequence:CCGGCTGTGAGACAAAGTTGGATAACTCGAGTTATCCAACTTTGTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-1007s21c1
Sequence:CCGGCCCTCATTTATATCCTTAATTCTCGAGAATTAAGGATATAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-844s21c1
Sequence:CCGGGAGACCAGAGCAGCCAGATAACTCGAGTTATCTGGCTGCTCTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-165s21c1
Sequence:CCGGAGCACCTGGACAATGATAATGCTCGAGCATTATCATTGTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009714.2-347s21c1
Sequence:CCGGCTGGCTCTAAGGCAGAATTTCCTCGAGGAAATTCTGCCTTAGAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-971s21c1
Sequence:CCGGACAAAGTTGGATAAGGCTAATCTCGAGATTAGCCTTATCCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009714
VALIDATED
ASGR1 MISSION shRNA shRNA Plasmid DNA
asialoglycoprotein receptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009714.1-1137s1c1
Sequence:CCGGGAACTGGTAGAGCCTACCTAACTCGAGTTAGGTAGGCTCTACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-262s1c1
Sequence:CCGGGACAATGATAATGACCATCATCTCGAGATGATGGTCATTATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-517s1c1
Sequence:CCGGGTGGGAAGAAAGATGAAGTTACTCGAGTAACTTCATCTTTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-1053s1c1
Sequence:CCGGCTGTGAGACAAAGTTGGATAACTCGAGTTATCCAACTTTGTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-1007s21c1
Sequence:CCGGCCCTCATTTATATCCTTAATTCTCGAGAATTAAGGATATAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-844s21c1
Sequence:CCGGGAGACCAGAGCAGCCAGATAACTCGAGTTATCTGGCTGCTCTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-165s21c1
Sequence:CCGGAGCACCTGGACAATGATAATGCTCGAGCATTATCATTGTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009714.2-347s21c1
Sequence:CCGGCTGGCTCTAAGGCAGAATTTCCTCGAGGAAATTCTGCCTTAGAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-971s21c1
Sequence:CCGGACAAAGTTGGATAAGGCTAATCTCGAGATTAGCCTTATCCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009714
VALIDATED
ASGR1 MISSION shRNA Lentiviral Transduction Particles
asialoglycoprotein receptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009714.1-1137s1c1
Sequence:CCGGGAACTGGTAGAGCCTACCTAACTCGAGTTAGGTAGGCTCTACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-262s1c1
Sequence:CCGGGACAATGATAATGACCATCATCTCGAGATGATGGTCATTATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-517s1c1
Sequence:CCGGGTGGGAAGAAAGATGAAGTTACTCGAGTAACTTCATCTTTCTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009714.1-1053s1c1
Sequence:CCGGCTGTGAGACAAAGTTGGATAACTCGAGTTATCCAACTTTGTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-1007s21c1
Sequence:CCGGCCCTCATTTATATCCTTAATTCTCGAGAATTAAGGATATAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-844s21c1
Sequence:CCGGGAGACCAGAGCAGCCAGATAACTCGAGTTATCTGGCTGCTCTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-165s21c1
Sequence:CCGGAGCACCTGGACAATGATAATGCTCGAGCATTATCATTGTCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009714.2-347s21c1
Sequence:CCGGCTGGCTCTAAGGCAGAATTTCCTCGAGGAAATTCTGCCTTAGAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009714.2-971s21c1
Sequence:CCGGACAAAGTTGGATAAGGCTAATCTCGAGATTAGCCTTATCCAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks