EMAIL THIS PAGE TO A FRIEND

ASGR2

asialoglycoprotein receptor 2

92 Gene Product Result for
Synonyms: ASGP-R2 ASGPR2 CLEC4H2 HBXBP HL-2
Gene ID:
Human(433) Summary: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(11890) asialoglycoprotein receptor 2
Rat(29403) asialoglycoprotein receptor 2
sheep(101115381) asialoglycoprotein receptor 2
domestic guinea pig(100714463) asialoglycoprotein receptor 2
naked mole-rat(101705711) asialoglycoprotein receptor 2
domestic cat(101095292) asialoglycoprotein receptor 2
cow(531519) asialoglycoprotein receptor 2
dog(100687999) asialoglycoprotein receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001181 Rosetta Predictions human pricing
NM_080912 Rosetta Predictions human pricing
NM_080913 Rosetta Predictions human pricing
NM_080914 Rosetta Predictions human pricing
NM_017189 Rosetta Predictions rat pricing
NM_007493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178775 predicted 1048
2 SASI_Hs02_00331309 predicted 972
3 SASI_Hs01_00178776 predicted 1207
4 SASI_Hs01_00178778 predicted 1013
5 SASI_Hs01_00178779 predicted 1010
6 SASI_Hs01_00178780 predicted 1207
7 SASI_Hs01_00178781 predicted 1077
8 SASI_Hs01_00178782 predicted 1045
9 SASI_Hs01_00178784 predicted 1010
10 SASI_Hs02_00331310 predicted 918
11 SASI_Hs01_00178777 predicted 933
12 SASI_Hs01_00178783 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118536 predicted 1137
2 SASI_Hs02_00362683 predicted 1069
3 SASI_Hs01_00118537 predicted 1288
4 SASI_Hs01_00118539 predicted 1098
5 SASI_Hs01_00118540 predicted 1098
6 SASI_Hs01_00118541 predicted 1297
7 SASI_Hs01_00118542 predicted 1166
8 SASI_Hs01_00118543 predicted 1128
9 SASI_Hs01_00118545 predicted 1097
10 SASI_Hs02_00362684 predicted 1006
11 SASI_Hs01_00118538 predicted 1015
12 SASI_Hs01_00118544 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113237 predicted 980
2 SASI_Hs02_00362685 predicted 900
3 SASI_Hs01_00113238 predicted 1131
4 SASI_Hs01_00113240 predicted 939
5 SASI_Hs01_00113241 predicted 941
6 SASI_Hs01_00113242 predicted 1131
7 SASI_Hs01_00113243 predicted 1003
8 SASI_Hs01_00113244 predicted 970
9 SASI_Hs01_00113246 predicted 936
10 SASI_Hs02_00362686 predicted 850
11 SASI_Hs01_00113239 predicted 856
12 SASI_Hs01_00113245 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086450 predicted 798
2 SASI_Hs02_00362687 predicted 722
3 SASI_Hs01_00086451 predicted 948
4 SASI_Hs01_00086453 predicted 757
5 SASI_Hs01_00086454 predicted 761
6 SASI_Hs01_00086455 predicted 949
7 SASI_Hs01_00086456 predicted 825
8 SASI_Hs01_00086457 predicted 788
9 SASI_Hs01_00086459 predicted 751
10 SASI_Hs02_00362688 predicted 665
11 SASI_Hs01_00086452 predicted 727
12 SASI_Hs01_00086458 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103959 predicted 1068
2 SASI_Rn01_00103960 predicted 928
3 SASI_Rn02_00261535 predicted 751
4 SASI_Rn01_00103961 predicted 1057
5 SASI_Rn02_00261536 predicted 925
6 SASI_Rn01_00103964 predicted 685
7 SASI_Rn01_00103965 predicted 941
8 SASI_Rn01_00103966 predicted 812
9 SASI_Rn01_00103967 predicted 965
10 SASI_Rn01_00103968 predicted 1041
11 SASI_Rn01_00103962 predicted 998
12 SASI_Rn01_00103963 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156024 predicted 507
2 SASI_Mm01_00156025 predicted 360
3 SASI_Mm01_00156026 predicted 666
4 SASI_Mm01_00156027 predicted 656
5 SASI_Mm01_00156028 predicted 333
6 SASI_Mm01_00156029 predicted 601
7 SASI_Mm01_00156030 predicted 277
8 SASI_Mm01_00156031 predicted 496
9 SASI_Mm01_00156032 predicted 415
10 SASI_Mm02_00311764 predicted 217
11 SASI_Mm01_00156023 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001181
ASGR2 MISSION shRNA Bacterial Glycerol Stock
asialoglycoprotein receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001181.3-1209s21c1
Sequence:CCGGACACCTCTGGCTAACCCATACCTCGAGGTATGGGTTAGCCAGAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001181.3-1248s21c1
Sequence:CCGCTGGCTTCTCTGTTGAGGATTTCTCGAGAAATCCTCAACAGAGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001181.3-1017s21c1
Sequence:CCGGACTATAGGCACAACTACAAGACTCGAGTCTTGTAGTTGTGCCTATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-313s1c1
Sequence:CCGGCCCAGGAGAGGAAATCCATTTCTCGAGAAATGGATTTCCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-654s1c1
Sequence:CCGGGCTCTTCCATCTGAAGCACTTCTCGAGAAGTGCTTCAGATGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-871s1c1
Sequence:CCGGGAGGAGCAGAAATTCATTGTACTCGAGTACAATGAATTTCTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-501s1c1
Sequence:CCGGCCTGAAGGAAGCTTTCAGCAACTCGAGTTGCTGAAAGCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-995s1c1
Sequence:CCGGCTGTCACTCAGCCAGATAATTCTCGAGAATTATCTGGCTGAGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001181
ASGR2 MISSION shRNA shRNA Plasmid DNA
asialoglycoprotein receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001181.3-1209s21c1
Sequence:CCGGACACCTCTGGCTAACCCATACCTCGAGGTATGGGTTAGCCAGAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001181.3-1248s21c1
Sequence:CCGCTGGCTTCTCTGTTGAGGATTTCTCGAGAAATCCTCAACAGAGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001181.3-1017s21c1
Sequence:CCGGACTATAGGCACAACTACAAGACTCGAGTCTTGTAGTTGTGCCTATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-313s1c1
Sequence:CCGGCCCAGGAGAGGAAATCCATTTCTCGAGAAATGGATTTCCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-654s1c1
Sequence:CCGGGCTCTTCCATCTGAAGCACTTCTCGAGAAGTGCTTCAGATGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-871s1c1
Sequence:CCGGGAGGAGCAGAAATTCATTGTACTCGAGTACAATGAATTTCTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-501s1c1
Sequence:CCGGCCTGAAGGAAGCTTTCAGCAACTCGAGTTGCTGAAAGCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-995s1c1
Sequence:CCGGCTGTCACTCAGCCAGATAATTCTCGAGAATTATCTGGCTGAGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001181
ASGR2 MISSION shRNA Lentiviral Transduction Particles
asialoglycoprotein receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001181.3-1209s21c1
Sequence:CCGGACACCTCTGGCTAACCCATACCTCGAGGTATGGGTTAGCCAGAGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001181.3-1248s21c1
Sequence:CCGCTGGCTTCTCTGTTGAGGATTTCTCGAGAAATCCTCAACAGAGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001181.3-1017s21c1
Sequence:CCGGACTATAGGCACAACTACAAGACTCGAGTCTTGTAGTTGTGCCTATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-313s1c1
Sequence:CCGGCCCAGGAGAGGAAATCCATTTCTCGAGAAATGGATTTCCTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-654s1c1
Sequence:CCGGGCTCTTCCATCTGAAGCACTTCTCGAGAAGTGCTTCAGATGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-871s1c1
Sequence:CCGGGAGGAGCAGAAATTCATTGTACTCGAGTACAATGAATTTCTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-501s1c1
Sequence:CCGGCCTGAAGGAAGCTTTCAGCAACTCGAGTTGCTGAAAGCTTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001181.2-995s1c1
Sequence:CCGGCTGTCACTCAGCCAGATAATTCTCGAGAATTATCTGGCTGAGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007493
ASGR2 MISSION shRNA Bacterial Glycerol Stock
asialoglycoprotein receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007493.2-1116s1c1
Sequence:CCGGACTAGGAGTCTGCTCAATCATCTCGAGATGATTGAGCAGACTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-824s1c1
Sequence:CCGGGAGCCAGTTTCATATTTGGATCTCGAGATCCAAATATGAAACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-880s1c1
Sequence:CCGGTGGATGGAACTGATTATAGAACTCGAGTTCTATAATCAGTTCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-434s1c1
Sequence:CCGGGAAAGAAACCTTCAGCAACTTCTCGAGAAGTTGCTGAAGGTTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-635s1c1
Sequence:CCGGGCTGGCGTACTTCCAGAGCAACTCGAGTTGCTCTGGAAGTACGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007493
ASGR2 MISSION shRNA shRNA Plasmid DNA
asialoglycoprotein receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007493.2-1116s1c1
Sequence:CCGGACTAGGAGTCTGCTCAATCATCTCGAGATGATTGAGCAGACTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-824s1c1
Sequence:CCGGGAGCCAGTTTCATATTTGGATCTCGAGATCCAAATATGAAACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-880s1c1
Sequence:CCGGTGGATGGAACTGATTATAGAACTCGAGTTCTATAATCAGTTCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-434s1c1
Sequence:CCGGGAAAGAAACCTTCAGCAACTTCTCGAGAAGTTGCTGAAGGTTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-635s1c1
Sequence:CCGGGCTGGCGTACTTCCAGAGCAACTCGAGTTGCTCTGGAAGTACGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007493
ASGR2 MISSION shRNA Lentiviral Transduction Particles
asialoglycoprotein receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007493.2-1116s1c1
Sequence:CCGGACTAGGAGTCTGCTCAATCATCTCGAGATGATTGAGCAGACTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-824s1c1
Sequence:CCGGGAGCCAGTTTCATATTTGGATCTCGAGATCCAAATATGAAACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-880s1c1
Sequence:CCGGTGGATGGAACTGATTATAGAACTCGAGTTCTATAATCAGTTCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-434s1c1
Sequence:CCGGGAAAGAAACCTTCAGCAACTTCTCGAGAAGTTGCTGAAGGTTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007493.2-635s1c1
Sequence:CCGGGCTGGCGTACTTCCAGAGCAACTCGAGTTGCTCTGGAAGTACGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks