EMAIL THIS PAGE TO A FRIEND

ASH1L

ash1 (absent, small, or homeotic)-like (Drosophila)

219 Gene Product Result for
Synonyms: ASH1 ASH1L1 KMT2H
UniProtKB ID: Q9NR48, Q59GP1, Q5T714, Q5T715, Q9P2C7
Gene ID:
Human(55870) Summary: This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
Mouse(192195) ash1 (absent, small, or homeotic)-like (Drosophila)
Rat(310638) ash1 (absent, small, or homeotic)-like (Drosophila)
Zebrafish(563799) ash1 (absent, small, or homeotic)-like (Drosophila)
chicken(425064) ash1 (absent, small, or homeotic)-like (Drosophila)
Horse(100057386) ash1 (absent, small, or homeotic)-like (Drosophila)
cow(540563) ash1 (absent, small, or homeotic)-like (Drosophila)
domestic cat(101086114) ash1 (absent, small, or homeotic)-like (Drosophila)
dog(480128) ash1 (absent, small, or homeotic)-like (Drosophila)
naked mole-rat(101723836) ash1 (absent, small, or homeotic)-like (Drosophila)
domestic guinea pig(100717586) ash1 (absent, small, or homeotic)-like (Drosophila)
sheep(101119775) ash1 (absent, small, or homeotic)-like (Drosophila)
Domestic Rabbit(100354541) ash1 (absent, small, or homeotic)-like (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018489 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018489 Rosetta Predictions human pricing
NM_001107689 Rosetta Predictions rat pricing
NM_138679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058209 predicted 4348
2 SASI_Hs01_00058210 predicted 498
3 SASI_Hs01_00058211 predicted 7930
4 SASI_Hs01_00058212 predicted 1782
5 SASI_Hs01_00058213 predicted 8680
6 SASI_Hs01_00058214 predicted 8029
7 SASI_Hs01_00058215 predicted 7099
8 SASI_Hs01_00058216 predicted 8073
9 SASI_Hs01_00058217 predicted 6734
10 SASI_Hs01_00058218 predicted 2312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231305 predicted 271
2 SASI_Rn02_00231306 predicted 2754
3 SASI_Rn02_00231307 predicted 4789
4 SASI_Rn02_00231308 predicted 5097
5 SASI_Rn02_00231309 predicted 3377
6 SASI_Rn02_00231310 predicted 397
7 SASI_Rn02_00231311 predicted 3745
8 SASI_Rn02_00231312 predicted 6744
9 SASI_Rn02_00231313 predicted 3166
10 SASI_Rn02_00231314 predicted 4925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035915 predicted 4265
2 SASI_Mm02_00339758 predicted 5033
3 SASI_Mm02_00339759 predicted 447
4 SASI_Mm01_00035916 predicted 1174
5 SASI_Mm01_00035917 predicted 4635
6 SASI_Mm02_00339760 predicted 1931
7 SASI_Mm02_00339761 predicted 2528
8 SASI_Mm01_00035920 predicted 1112
9 SASI_Mm01_00035921 predicted 2482
10 SASI_Mm01_00035922 predicted 3593
11 SASI_Mm01_00035918 predicted 6710
12 SASI_Mm01_00035919 predicted 3862
13 SASI_Mm01_00035923 predicted 4652
14 SASI_Mm01_00035924 predicted 4777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138679
VALIDATED
ASH1L MISSION shRNA Bacterial Glycerol Stock
ash1 (absent, small, or homeotic)-like (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138679.1-3171s1c1
Sequence:CCGGGCTGCCACATTTGGCTCTAAACTCGAGTTTAGAGCCAAATGTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-4380s1c1
Sequence:CCGGGCTGGTCATTTATTGCTCAATCTCGAGATTGAGCAATAAATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-3582s1c1
Sequence:CCGGCCTCCTACTTTGTTGCCAAATCTCGAGATTTGGCAACAAAGTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-5021s1c1
Sequence:CCGGGCCTCACAGAAAGGAACCATTCTCGAGAATGGTTCCTTTCTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-6177s1c1
Sequence:CCGGCCCATTCATGTTGGAAAGTATCTCGAGATACTTTCCAACATGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138679.5-9324s21c1
Sequence:CCGGAGCTACGTCAGAGACCTAAACCTCGAGGTTTAGGTCTCTGACGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-688s21c1
Sequence:CCGGCAGTCGAGATCCTGATATAAACTCGAGTTTATATCAGGATCTCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-5020s21c1
Sequence:CCGGGCCTCACAGAAAGGAACCATTCTCGAGAATGGTTCCTTTCTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-3581s21c1
Sequence:CCGGCCTCCTACTTTGTTGCCAAATCTCGAGATTTGGCAACAAAGTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-4379s21c1
Sequence:CCGGGCTGGTCATTTATTGCTCAATCTCGAGATTGAGCAATAAATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138679
VALIDATED
ASH1L MISSION shRNA shRNA Plasmid DNA
ash1 (absent, small, or homeotic)-like (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138679.1-3171s1c1
Sequence:CCGGGCTGCCACATTTGGCTCTAAACTCGAGTTTAGAGCCAAATGTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-4380s1c1
Sequence:CCGGGCTGGTCATTTATTGCTCAATCTCGAGATTGAGCAATAAATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-3582s1c1
Sequence:CCGGCCTCCTACTTTGTTGCCAAATCTCGAGATTTGGCAACAAAGTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-5021s1c1
Sequence:CCGGGCCTCACAGAAAGGAACCATTCTCGAGAATGGTTCCTTTCTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-6177s1c1
Sequence:CCGGCCCATTCATGTTGGAAAGTATCTCGAGATACTTTCCAACATGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138679.5-9324s21c1
Sequence:CCGGAGCTACGTCAGAGACCTAAACCTCGAGGTTTAGGTCTCTGACGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-688s21c1
Sequence:CCGGCAGTCGAGATCCTGATATAAACTCGAGTTTATATCAGGATCTCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-5020s21c1
Sequence:CCGGGCCTCACAGAAAGGAACCATTCTCGAGAATGGTTCCTTTCTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-3581s21c1
Sequence:CCGGCCTCCTACTTTGTTGCCAAATCTCGAGATTTGGCAACAAAGTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-4379s21c1
Sequence:CCGGGCTGGTCATTTATTGCTCAATCTCGAGATTGAGCAATAAATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138679
VALIDATED
ASH1L MISSION shRNA Lentiviral Transduction Particles
ash1 (absent, small, or homeotic)-like (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138679.1-3171s1c1
Sequence:CCGGGCTGCCACATTTGGCTCTAAACTCGAGTTTAGAGCCAAATGTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-4380s1c1
Sequence:CCGGGCTGGTCATTTATTGCTCAATCTCGAGATTGAGCAATAAATGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-3582s1c1
Sequence:CCGGCCTCCTACTTTGTTGCCAAATCTCGAGATTTGGCAACAAAGTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-5021s1c1
Sequence:CCGGGCCTCACAGAAAGGAACCATTCTCGAGAATGGTTCCTTTCTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138679.1-6177s1c1
Sequence:CCGGCCCATTCATGTTGGAAAGTATCTCGAGATACTTTCCAACATGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138679.5-9324s21c1
Sequence:CCGGAGCTACGTCAGAGACCTAAACCTCGAGGTTTAGGTCTCTGACGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-688s21c1
Sequence:CCGGCAGTCGAGATCCTGATATAAACTCGAGTTTATATCAGGATCTCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-5020s21c1
Sequence:CCGGGCCTCACAGAAAGGAACCATTCTCGAGAATGGTTCCTTTCTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-3581s21c1
Sequence:CCGGCCTCCTACTTTGTTGCCAAATCTCGAGATTTGGCAACAAAGTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138679.5-4379s21c1
Sequence:CCGGGCTGGTCATTTATTGCTCAATCTCGAGATTGAGCAATAAATGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018489
VALIDATED
ASH1L MISSION shRNA Bacterial Glycerol Stock
ash1 (absent, small, or homeotic)-like (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018489.1-4615s1c1
Sequence:CCGGCCTGCCAAATACCATAAGAAACTCGAGTTTCTTATGGTATTTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018489.1-9181s1c1
Sequence:CCGGCGTACTTTGTTTATCCCAGAACTCGAGTTCTGGGATAAACAAAGTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018489.1-8395s1c1
Sequence:CCGGCGACATAAACTTGACATCTTTCTCGAGAAAGATGTCAAGTTTATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018489.1-2022s1c1
Sequence:CCGGCCCTGAAACTTCTTCACAGTTCTCGAGAACTGTGAAGAAGTTTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-5046s21c1
Sequence:CCGGTGCTGTTGGAGAGCGATATAACTCGAGTTATATCGCTCTCCAACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018489.2-7961s21c1
Sequence:CCGGAGATCCTCACTGGTTACTATACTCGAGTATAGTAACCAGTGAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-9599s21c1
Sequence:CCGGCTTCACCTTAAGGGTTAATAACTCGAGTTATTAACCCTTAAGGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-6495s21c2
Sequence:GTACCGGGAGTCGATTGATCCAATTAAACTCGAGTTTAATTGGATCAATCGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-7026s21c2
Sequence:GTACCGGGATGATTGAGCAGTATCATAACTCGAGTTATGATACTGCTCAATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018489.2-10042s21c2
Sequence:CCGGCGGTAGTTCTTGCAATTATTTCTCGAGAAATAATTGCAAGAACTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018489.2-8661s21c2
Sequence:CCGGATCCCGTCGGTTCTATCATAACTCGAGTTATGATAGAACCGACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-8077s21c2
Sequence:CCGGCGTCTACGAAAGGCCTATTACCTCGAGGTAATAGGCCTTTCGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018489
VALIDATED
ASH1L MISSION shRNA shRNA Plasmid DNA
ash1 (absent, small, or homeotic)-like (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018489.1-4615s1c1
Sequence:CCGGCCTGCCAAATACCATAAGAAACTCGAGTTTCTTATGGTATTTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018489.1-9181s1c1
Sequence:CCGGCGTACTTTGTTTATCCCAGAACTCGAGTTCTGGGATAAACAAAGTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018489.1-8395s1c1
Sequence:CCGGCGACATAAACTTGACATCTTTCTCGAGAAAGATGTCAAGTTTATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018489.1-2022s1c1
Sequence:CCGGCCCTGAAACTTCTTCACAGTTCTCGAGAACTGTGAAGAAGTTTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-5046s21c1
Sequence:CCGGTGCTGTTGGAGAGCGATATAACTCGAGTTATATCGCTCTCCAACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018489.2-7961s21c1
Sequence:CCGGAGATCCTCACTGGTTACTATACTCGAGTATAGTAACCAGTGAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-9599s21c1
Sequence:CCGGCTTCACCTTAAGGGTTAATAACTCGAGTTATTAACCCTTAAGGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-6495s21c2
Sequence:GTACCGGGAGTCGATTGATCCAATTAAACTCGAGTTTAATTGGATCAATCGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-7026s21c2
Sequence:GTACCGGGATGATTGAGCAGTATCATAACTCGAGTTATGATACTGCTCAATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018489.2-10042s21c2
Sequence:CCGGCGGTAGTTCTTGCAATTATTTCTCGAGAAATAATTGCAAGAACTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018489.2-8661s21c2
Sequence:CCGGATCCCGTCGGTTCTATCATAACTCGAGTTATGATAGAACCGACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-8077s21c2
Sequence:CCGGCGTCTACGAAAGGCCTATTACCTCGAGGTAATAGGCCTTTCGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018489
VALIDATED
ASH1L MISSION shRNA Lentiviral Transduction Particles
ash1 (absent, small, or homeotic)-like (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018489.1-4615s1c1
Sequence:CCGGCCTGCCAAATACCATAAGAAACTCGAGTTTCTTATGGTATTTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018489.1-9181s1c1
Sequence:CCGGCGTACTTTGTTTATCCCAGAACTCGAGTTCTGGGATAAACAAAGTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018489.1-8395s1c1
Sequence:CCGGCGACATAAACTTGACATCTTTCTCGAGAAAGATGTCAAGTTTATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018489.1-2022s1c1
Sequence:CCGGCCCTGAAACTTCTTCACAGTTCTCGAGAACTGTGAAGAAGTTTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-5046s21c1
Sequence:CCGGTGCTGTTGGAGAGCGATATAACTCGAGTTATATCGCTCTCCAACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018489.2-7961s21c1
Sequence:CCGGAGATCCTCACTGGTTACTATACTCGAGTATAGTAACCAGTGAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-9599s21c1
Sequence:CCGGCTTCACCTTAAGGGTTAATAACTCGAGTTATTAACCCTTAAGGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-6495s21c2
Sequence:GTACCGGGAGTCGATTGATCCAATTAAACTCGAGTTTAATTGGATCAATCGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-7026s21c2
Sequence:GTACCGGGATGATTGAGCAGTATCATAACTCGAGTTATGATACTGCTCAATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018489.2-10042s21c2
Sequence:CCGGCGGTAGTTCTTGCAATTATTTCTCGAGAAATAATTGCAAGAACTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018489.2-8661s21c2
Sequence:CCGGATCCCGTCGGTTCTATCATAACTCGAGTTATGATAGAACCGACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018489.2-8077s21c2
Sequence:CCGGCGTCTACGAAAGGCCTATTACCTCGAGGTAATAGGCCTTTCGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)