EMAIL THIS PAGE TO A FRIEND

ASH2L

ash2 (absent, small, or homeotic)-like (Drosophila)

108 Gene Product Result for
Synonyms: ASH2 ASH2L1 ASH2L2 Bre2
UniProtKB ID: Q9UBL3, A8K7C3, D3DSW9, O60659, O60660, Q96B62
Gene ID:
Mouse(23808) ash2 (absent, small, or homeotic)-like (Drosophila)
Rat(290829) ash2 (absent, small, or homeotic)-like (Drosophila)
Zebrafish(558193) ash2 (absent, small, or homeotic)-like (Drosophila)
cow(100138350) ash2 (absent, small, or homeotic)-like (Drosophila)
Horse(100059465) ash2 (absent, small, or homeotic)-like (Drosophila)
domestic cat(101088324) ash2 (absent, small, or homeotic)-like (Drosophila)
dog(475589) ash2 (absent, small, or homeotic)-like (Drosophila)
chicken(426774) ash2 (absent, small, or homeotic)-like (Drosophila)
sheep(101111689) ash2 (absent, small, or homeotic)-like (Drosophila)
domestic guinea pig(100732899) ash2 (absent, small, or homeotic)-like (Drosophila)
naked mole-rat(101709307) ash2 (absent, small, or homeotic)-like (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100164 Anti-ASH2L (ab1) antibody produced in rabbit affinity isolated antibody canine, human, horse
western blot pricing
SAB2100165 Anti-ASH2L (ab2) antibody produced in rabbit affinity isolated antibody bovine, canine, guinea pig, mouse, human, rat, horse, rabbit
western blot pricing
AV34203 Anti-ASH2L antibody produced in rabbit affinity isolated antibody canine, zebrafish, human, bovine, mouse, horse, rat, guinea pig
western blot pricing
SAB4300685 Anti-ASH2L antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA042289 Anti-ASH2L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1404665 Monoclonal Anti-ASH2L antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0028 Rabbit anti-ASH2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. pig, dog, primate, chimpanzee, bovine, guinea pig, gorilla, gibbon, rat, rhesus monkey, horse, human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077281 MISSION® esiRNA esiRNA targeting mouse Ash2l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105214 Rosetta Predictions human pricing
NM_004674 Rosetta Predictions human pricing
NM_001106089 Rosetta Predictions rat pricing
NM_001080793 Rosetta Predictions mouse pricing
NM_011791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324024 predicted 2022
2 SASI_Hs02_00324025 predicted 811
3 SASI_Hs02_00324026 predicted 1474
4 SASI_Hs02_00324027 predicted 1125
5 SASI_Hs02_00324028 predicted 1354
6 SASI_Hs02_00324029 predicted 1111
7 SASI_Hs02_00324030 predicted 1545
8 SASI_Hs02_00324031 predicted 1509
9 SASI_Hs02_00324032 predicted 1211
10 SASI_Hs02_00324033 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139134 predicted 1966
2 SASI_Hs01_00139135 predicted 746
3 SASI_Hs01_00139136 predicted 1404
4 SASI_Hs01_00139138 predicted 1059
5 SASI_Hs02_00338104 predicted 1285
6 SASI_Hs01_00139140 predicted 1041
7 SASI_Hs01_00139141 predicted 1477
8 SASI_Hs01_00139143 predicted 1450
9 SASI_Hs02_00338105 predicted 1150
10 SASI_Hs02_00338106 predicted 1237
11 SASI_Hs01_00139137 predicted 344
12 SASI_Hs01_00139139 predicted 840
13 SASI_Hs01_00139142 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215522 predicted 571
2 SASI_Rn02_00215523 predicted 1001
3 SASI_Rn02_00215524 predicted 1101
4 SASI_Rn02_00215525 predicted 930
5 SASI_Rn02_00215526 predicted 575
6 SASI_Rn02_00215527 predicted 986
7 SASI_Rn02_00215528 predicted 1390
8 SASI_Rn02_00215529 predicted 1637
9 SASI_Rn02_00215530 predicted 1502
10 SASI_Rn02_00215531 predicted 1762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293763 predicted 692
2 SASI_Mm02_00293764 predicted 906
3 SASI_Mm02_00293765 predicted 481
4 SASI_Mm02_00293766 predicted 994
5 SASI_Mm02_00293767 predicted 406
6 SASI_Mm02_00293768 predicted 1649
7 SASI_Mm02_00293769 predicted 883
8 SASI_Mm02_00293770 predicted 1652
9 SASI_Mm02_00293771 predicted 463
10 SASI_Mm02_00293772 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321442 predicted 801
2 SASI_Mm01_00164755 predicted 1010
3 SASI_Mm01_00164756 predicted 586
4 SASI_Mm01_00164758 predicted 1101
5 SASI_Mm01_00164763 predicted 507
6 SASI_Mm01_00164764 predicted 1755
7 SASI_Mm02_00321443 predicted 994
8 SASI_Mm02_00321444 predicted 1756
9 SASI_Mm02_00321445 predicted 567
10 SASI_Mm02_00321446 predicted 1984
11 SASI_Mm01_00164757 predicted 1538
12 SASI_Mm01_00164759 predicted 1356
13 SASI_Mm01_00164760 predicted 1741
14 SASI_Mm01_00164761 predicted 1636
15 SASI_Mm01_00164762 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004674
VALIDATED
ASH2L MISSION shRNA Bacterial Glycerol Stock
ash2 (absent, small, or homeotic)-like (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004674.3-250s21c1
Sequence:GTACCGGGGCAAACTTGGTCGATGTAAGCTCGAGCTTACATCGACCAAGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-380s1c1
Sequence:CCGGGCTGACACATTTGGCATAGATCTCGAGATCTATGCCAAATGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-1006s1c1
Sequence:CCGGCCCGTTTAACAAAGATGGCTACTCGAGTAGCCATCTTTGTTAAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-1128s1c1
Sequence:CCGGCCTGCTTGTATGAACGGGTTTCTCGAGAAACCCGTTCATACAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-563s1c1
Sequence:CCGGCCGAAGACAATGTTCTCCAAACTCGAGTTTGGAGAACATTGTCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-2177s1c1
Sequence:CCGGGTGACTTGTTATCCTACTATACTCGAGTATAGTAGGATAACAAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004674
VALIDATED
ASH2L MISSION shRNA shRNA Plasmid DNA
ash2 (absent, small, or homeotic)-like (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004674.3-250s21c1
Sequence:GTACCGGGGCAAACTTGGTCGATGTAAGCTCGAGCTTACATCGACCAAGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-380s1c1
Sequence:CCGGGCTGACACATTTGGCATAGATCTCGAGATCTATGCCAAATGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-1006s1c1
Sequence:CCGGCCCGTTTAACAAAGATGGCTACTCGAGTAGCCATCTTTGTTAAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-1128s1c1
Sequence:CCGGCCTGCTTGTATGAACGGGTTTCTCGAGAAACCCGTTCATACAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-563s1c1
Sequence:CCGGCCGAAGACAATGTTCTCCAAACTCGAGTTTGGAGAACATTGTCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-2177s1c1
Sequence:CCGGGTGACTTGTTATCCTACTATACTCGAGTATAGTAGGATAACAAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004674
VALIDATED
ASH2L MISSION shRNA Lentiviral Transduction Particles
ash2 (absent, small, or homeotic)-like (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004674.3-250s21c1
Sequence:GTACCGGGGCAAACTTGGTCGATGTAAGCTCGAGCTTACATCGACCAAGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-380s1c1
Sequence:CCGGGCTGACACATTTGGCATAGATCTCGAGATCTATGCCAAATGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-1006s1c1
Sequence:CCGGCCCGTTTAACAAAGATGGCTACTCGAGTAGCCATCTTTGTTAAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-1128s1c1
Sequence:CCGGCCTGCTTGTATGAACGGGTTTCTCGAGAAACCCGTTCATACAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-563s1c1
Sequence:CCGGCCGAAGACAATGTTCTCCAAACTCGAGTTTGGAGAACATTGTCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004674.1-2177s1c1
Sequence:CCGGGTGACTTGTTATCCTACTATACTCGAGTATAGTAGGATAACAAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011791
VALIDATED
ASH2L MISSION shRNA Bacterial Glycerol Stock
ash2 (absent, small, or homeotic)-like (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1356s21c1
Sequence:CCGGCCTTAGGCTATGATAAGTTTACTCGAGTAAACTTATCATAGCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1513s21c1
Sequence:CCGGGCCGGACACCTACAAAGATAACTCGAGTTATCTTTGTAGGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1010s21c1
Sequence:CCGGCCATTTAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1145s21c1
Sequence:CCGGCGAGTCTTGTTAGCCCTACATCTCGAGATGTAGGGCTAACAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011791.1-1346s1c1
Sequence:CCGGCCTTAGGCTATGATAAGTTTACTCGAGTAAACTTATCATAGCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011791.1-2135s1c1
Sequence:CCGGCCTGTGTCTGTGTGTTCCAAACTCGAGTTTGGAACACACAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1135s1c1
Sequence:CCGGCGAGTCTTGTTAGCCCTACATCTCGAGATGTAGGGCTAACAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1503s1c1
Sequence:CCGGGCCGGACACCTACAAAGATAACTCGAGTTATCTTTGTAGGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1000s1c1
Sequence:CCGGCCATTTAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011791
VALIDATED
ASH2L MISSION shRNA shRNA Plasmid DNA
ash2 (absent, small, or homeotic)-like (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1356s21c1
Sequence:CCGGCCTTAGGCTATGATAAGTTTACTCGAGTAAACTTATCATAGCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1513s21c1
Sequence:CCGGGCCGGACACCTACAAAGATAACTCGAGTTATCTTTGTAGGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1010s21c1
Sequence:CCGGCCATTTAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1145s21c1
Sequence:CCGGCGAGTCTTGTTAGCCCTACATCTCGAGATGTAGGGCTAACAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011791.1-1346s1c1
Sequence:CCGGCCTTAGGCTATGATAAGTTTACTCGAGTAAACTTATCATAGCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011791.1-2135s1c1
Sequence:CCGGCCTGTGTCTGTGTGTTCCAAACTCGAGTTTGGAACACACAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1135s1c1
Sequence:CCGGCGAGTCTTGTTAGCCCTACATCTCGAGATGTAGGGCTAACAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1503s1c1
Sequence:CCGGGCCGGACACCTACAAAGATAACTCGAGTTATCTTTGTAGGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1000s1c1
Sequence:CCGGCCATTTAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011791
VALIDATED
ASH2L MISSION shRNA Lentiviral Transduction Particles
ash2 (absent, small, or homeotic)-like (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1356s21c1
Sequence:CCGGCCTTAGGCTATGATAAGTTTACTCGAGTAAACTTATCATAGCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1513s21c1
Sequence:CCGGGCCGGACACCTACAAAGATAACTCGAGTTATCTTTGTAGGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1010s21c1
Sequence:CCGGCCATTTAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011791.2-1145s21c1
Sequence:CCGGCGAGTCTTGTTAGCCCTACATCTCGAGATGTAGGGCTAACAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011791.1-1346s1c1
Sequence:CCGGCCTTAGGCTATGATAAGTTTACTCGAGTAAACTTATCATAGCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011791.1-2135s1c1
Sequence:CCGGCCTGTGTCTGTGTGTTCCAAACTCGAGTTTGGAACACACAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1135s1c1
Sequence:CCGGCGAGTCTTGTTAGCCCTACATCTCGAGATGTAGGGCTAACAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1503s1c1
Sequence:CCGGGCCGGACACCTACAAAGATAACTCGAGTTATCTTTGTAGGTGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011791.1-1000s1c1
Sequence:CCGGCCATTTAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks