EMAIL THIS PAGE TO A FRIEND

ASIC1

acid-sensing (proton-gated) ion channel 1

190 Gene Product Result for
Synonyms: ACCN2 ASIC BNaC2
UniProtKB ID: P78348, A3KN86, E5KBL7, P78349, Q96CV2
Gene ID:
Human(41) Summary: This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
Mouse(11419) acid-sensing (proton-gated) ion channel 1
Rat(79123) acid-sensing (proton-gated) ion channel 1
domestic cat(101085729) acid-sensing (proton-gated) ion channel 1
naked mole-rat(101703554) acid-sensing (proton-gated) ion channel 1
domestic guinea pig(100720903) acid-sensing (proton-gated) ion channel 1
sheep(101120562) acid-sensing (proton-gated) ion channel 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108751 Anti-ACCN2 affinity isolated antibody horse, rabbit, rat, mouse, human, bovine, guinea pig, canine
western blot pricing
SAB2700875 Anti-ACCN2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2106350 Anti-ACCN2 antibody produced in rabbit affinity isolated antibody horse, human, mouse, guinea pig, rabbit
ELISA, western blot pricing
SAB2104215 Anti-ACCN2, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, mouse, horse, human, rat, guinea pig
western blot pricing
HPA058870 Anti-ASIC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4301193 Anti-ASIC1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
S7944 Anti-Sodium Channel ASIC1 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, human, mouse
immunohistochemistry, western blot pricing
SAB5200861 Monoclonal Anti-Asic1 - Alkaline Phosphatase antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200862 Monoclonal Anti-Asic1 - Apc antibody produced in mouse clone S271-44, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200853 Monoclonal Anti-Asic1 - Atto 390 antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200854 Monoclonal Anti-Asic1 - Atto 488 antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200855 Monoclonal Anti-Asic1 - Atto 565 antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200856 Monoclonal Anti-Asic1 - Atto 594 antibody produced in mouse clone S271-44, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200857 Monoclonal Anti-Asic1 - Atto 633 antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200858 Monoclonal Anti-Asic1 - Atto 655 antibody produced in mouse clone S271-44, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200859 Monoclonal Anti-Asic1 - Atto 680 antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200860 Monoclonal Anti-Asic1 - Atto 700 antibody produced in mouse clone S271-44, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200863 Monoclonal Anti-Asic1 - Biotin antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200864 Monoclonal Anti-Asic1 - Fitc antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200865 Monoclonal Anti-Asic1 - Hrp antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200866 Monoclonal Anti-Asic1 - Pe/Atto 594 antibody produced in mouse clone S271-44, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200867 Monoclonal Anti-Asic1 - Percp antibody produced in mouse clone S271-44, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200868 Monoclonal Anti-Asic1 - Rpe antibody produced in mouse clone S271-44, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200869 Monoclonal Anti-Asic1 - Streptavidin antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200852 Monoclonal Anti-Asic1 antibody produced in mouse clone S271-44, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A7410 Amiloride hydrochloride hydrate ≥98% (TLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001095 Rosetta Predictions human pricing
NM_020039 Rosetta Predictions human pricing
NM_024154 Rosetta Predictions rat pricing
NM_009597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167899 predicted 521
2 SASI_Hs02_00318217 predicted 649
3 SASI_Hs01_00167900 predicted 675
4 SASI_Hs02_00318218 predicted 656
5 SASI_Hs01_00167902 predicted 945
6 SASI_Hs01_00167903 predicted 1955
7 SASI_Hs01_00167904 predicted 1101
8 SASI_Hs01_00167905 predicted 770
9 SASI_Hs01_00167906 predicted 952
10 SASI_Hs01_00167907 predicted 1113
11 SASI_Hs01_00167898 predicted 2108
12 SASI_Hs01_00167901 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185845 predicted 515
2 SASI_Hs02_00352942 predicted 649
3 SASI_Hs01_00185846 predicted 679
4 SASI_Hs02_00352943 predicted 657
5 SASI_Hs01_00185848 predicted 946
6 SASI_Hs01_00185849 predicted 2093
7 SASI_Hs01_00185850 predicted 1094
8 SASI_Hs01_00185851 predicted 770
9 SASI_Hs01_00185852 predicted 951
10 SASI_Hs01_00185853 predicted 1118
11 SASI_Hs01_00185844 predicted 2239
12 SASI_Hs01_00185847 predicted 2249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042362 predicted 662
2 SASI_Rn01_00042363 predicted 838
3 SASI_Rn01_00042365 predicted 1296
4 SASI_Rn01_00042366 predicted 991
5 SASI_Rn01_00042367 predicted 1251
6 SASI_Rn01_00042368 predicted 1386
7 SASI_Rn01_00042369 predicted 1322
8 SASI_Rn01_00042370 predicted 697
9 SASI_Rn01_00042371 predicted 998
10 SASI_Rn02_00263886 predicted 411
11 SASI_Rn01_00042364 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122453 predicted 1554
2 SASI_Mm01_00122454 predicted 637
3 SASI_Mm01_00122455 predicted 1114
4 SASI_Mm01_00122456 predicted 906
5 SASI_Mm01_00122458 predicted 747
6 SASI_Mm01_00122459 predicted 484
7 SASI_Mm01_00122460 predicted 1443
8 SASI_Mm01_00122461 predicted 1061
9 SASI_Mm01_00122462 predicted 1452
10 SASI_Mm02_00316512 predicted 1458
11 SASI_Mm01_00122457 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001095
VALIDATED
ASIC1 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-1603s1c1
Sequence:CCGGCGAGGTCATTAAGCACAAGCTCTCGAGAGCTTGTGCTTAATGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-580s1c1
Sequence:CCGGGCTCAACAACAGGTATGAGATCTCGAGATCTCATACCTGTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-670s1c1
Sequence:CCGGCAAACCCAAACCCTTCAACATCTCGAGATGTTGAAGGGTTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001095.2-2983s1c1
Sequence:CCGGGCGACAAAGGAAGCTGTGAATCTCGAGATTCACAGCTTCCTTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-1119s1c1
Sequence:CCGGCGGATTTGGATTTCTTCGACTCTCGAGAGTCGAAGAAATCCAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001095.2-799s1c1
Sequence:CCGGCTATGGAAAGTGCTACACGTTCTCGAGAACGTGTAGCACTTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001095.2-2441s1c1
Sequence:CCGGGCTGTAGGCTACATCCTGATACTCGAGTATCAGGATGTAGCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001095.2-2983s21c1
Sequence:CCGGGCGACAAAGGAAGCTGTGAATCTCGAGATTCACAGCTTCCTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001095.2-580s21c1
Sequence:CCGGGCTCAACAACAGGTATGAGATCTCGAGATCTCATACCTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001095.2-2441s21c1
Sequence:CCGGGCTGTAGGCTACATCCTGATACTCGAGTATCAGGATGTAGCCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001095.2-799s21c1
Sequence:CCGGCTATGGAAAGTGCTACACGTTCTCGAGAACGTGTAGCACTTTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001095
VALIDATED
ASIC1 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-1603s1c1
Sequence:CCGGCGAGGTCATTAAGCACAAGCTCTCGAGAGCTTGTGCTTAATGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-580s1c1
Sequence:CCGGGCTCAACAACAGGTATGAGATCTCGAGATCTCATACCTGTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-670s1c1
Sequence:CCGGCAAACCCAAACCCTTCAACATCTCGAGATGTTGAAGGGTTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001095.2-2983s1c1
Sequence:CCGGGCGACAAAGGAAGCTGTGAATCTCGAGATTCACAGCTTCCTTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-1119s1c1
Sequence:CCGGCGGATTTGGATTTCTTCGACTCTCGAGAGTCGAAGAAATCCAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001095.2-799s1c1
Sequence:CCGGCTATGGAAAGTGCTACACGTTCTCGAGAACGTGTAGCACTTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001095.2-2441s1c1
Sequence:CCGGGCTGTAGGCTACATCCTGATACTCGAGTATCAGGATGTAGCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001095.2-2983s21c1
Sequence:CCGGGCGACAAAGGAAGCTGTGAATCTCGAGATTCACAGCTTCCTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001095.2-580s21c1
Sequence:CCGGGCTCAACAACAGGTATGAGATCTCGAGATCTCATACCTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001095.2-2441s21c1
Sequence:CCGGGCTGTAGGCTACATCCTGATACTCGAGTATCAGGATGTAGCCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001095.2-799s21c1
Sequence:CCGGCTATGGAAAGTGCTACACGTTCTCGAGAACGTGTAGCACTTTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001095
VALIDATED
ASIC1 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-1603s1c1
Sequence:CCGGCGAGGTCATTAAGCACAAGCTCTCGAGAGCTTGTGCTTAATGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-580s1c1
Sequence:CCGGGCTCAACAACAGGTATGAGATCTCGAGATCTCATACCTGTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-670s1c1
Sequence:CCGGCAAACCCAAACCCTTCAACATCTCGAGATGTTGAAGGGTTTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001095.2-2983s1c1
Sequence:CCGGGCGACAAAGGAAGCTGTGAATCTCGAGATTCACAGCTTCCTTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001095.2-1119s1c1
Sequence:CCGGCGGATTTGGATTTCTTCGACTCTCGAGAGTCGAAGAAATCCAAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001095.2-799s1c1
Sequence:CCGGCTATGGAAAGTGCTACACGTTCTCGAGAACGTGTAGCACTTTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001095.2-2441s1c1
Sequence:CCGGGCTGTAGGCTACATCCTGATACTCGAGTATCAGGATGTAGCCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001095.2-2983s21c1
Sequence:CCGGGCGACAAAGGAAGCTGTGAATCTCGAGATTCACAGCTTCCTTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001095.2-580s21c1
Sequence:CCGGGCTCAACAACAGGTATGAGATCTCGAGATCTCATACCTGTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001095.2-2441s21c1
Sequence:CCGGGCTGTAGGCTACATCCTGATACTCGAGTATCAGGATGTAGCCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001095.2-799s21c1
Sequence:CCGGCTATGGAAAGTGCTACACGTTCTCGAGAACGTGTAGCACTTTCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009597
ASIC1 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000175504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009597.1-2331s1c1
Sequence:CCGGCCTCAAGCATACGGAATCTTTCTCGAGAAAGATTCCGTATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1113s1c1
Sequence:CCGGCCTGCCGGATTGATTGTGAAACTCGAGTTTCACAATCAATCCGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1753s1c1
Sequence:CCGGGTTTGAGGACTTTACCTGCTACTCGAGTAGCAGGTAAAGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1550s1c1
Sequence:CCGGGACTATGCCTATGAGGTCATTCTCGAGAATGACCTCATAGGCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009597
ASIC1 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000175504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009597.1-2331s1c1
Sequence:CCGGCCTCAAGCATACGGAATCTTTCTCGAGAAAGATTCCGTATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1113s1c1
Sequence:CCGGCCTGCCGGATTGATTGTGAAACTCGAGTTTCACAATCAATCCGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1753s1c1
Sequence:CCGGGTTTGAGGACTTTACCTGCTACTCGAGTAGCAGGTAAAGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1550s1c1
Sequence:CCGGGACTATGCCTATGAGGTCATTCTCGAGAATGACCTCATAGGCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009597
ASIC1 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000175504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009597.1-2331s1c1
Sequence:CCGGCCTCAAGCATACGGAATCTTTCTCGAGAAAGATTCCGTATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1113s1c1
Sequence:CCGGCCTGCCGGATTGATTGTGAAACTCGAGTTTCACAATCAATCCGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1753s1c1
Sequence:CCGGGTTTGAGGACTTTACCTGCTACTCGAGTAGCAGGTAAAGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009597.1-1550s1c1
Sequence:CCGGGACTATGCCTATGAGGTCATTCTCGAGAATGACCTCATAGGCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks