EMAIL THIS PAGE TO A FRIEND

ASIC2

acid-sensing (proton-gated) ion channel 2

Synonyms: ACCN ACCN1 ASIC2a BNC1 BNaC1 MDEG hBNaC1
UniProtKB ID: Q16515, E9PBX2, Q13553, Q6DJU1, Q8N3E2
Gene ID:
Human(40) Summary: This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
Mouse(11418) acid-sensing (proton-gated) ion channel 2
Rat(25364) acid-sensing (proton-gated) ion channel 2
Zebrafish(407669) acid-sensing (proton-gated) ion channel 2
domestic cat(101096183) acid-sensing (proton-gated) ion channel 2
sheep(101120341) acid-sensing (proton-gated) ion channel 2
domestic guinea pig(100717745) acid-sensing (proton-gated) ion channel 2
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A7410 Amiloride hydrochloride hydrate ≥98% (TLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001094 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065621 MISSION® esiRNA esiRNA human ACCN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001094 Rosetta Predictions human pricing
NM_183377 Rosetta Predictions human pricing
NM_001034014 Rosetta Predictions rat pricing
NM_012892 Rosetta Predictions rat pricing
NM_001034013 Rosetta Predictions mouse pricing
NM_007384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176210 predicted 1471
2 SASI_Hs01_00176211 predicted 2063
3 SASI_Hs02_00318216 predicted 1469
4 SASI_Hs01_00176212 predicted 1699
5 SASI_Hs01_00176213 predicted 1145
6 SASI_Hs01_00176214 predicted 1718
7 SASI_Hs01_00176215 predicted 1537
8 SASI_Hs01_00176216 predicted 1640
9 SASI_Hs01_00176217 predicted 1651
10 SASI_Hs01_00176218 predicted 1413
11 SASI_Hs01_00176219 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169413 predicted 2220
2 SASI_Hs01_00169414 predicted 2812
3 SASI_Hs02_00371285 predicted 2219
4 SASI_Hs01_00169415 predicted 2456
5 SASI_Hs01_00169416 predicted 1893
6 SASI_Hs01_00169417 predicted 2468
7 SASI_Hs01_00169418 predicted 2281
8 SASI_Hs01_00169419 predicted 2390
9 SASI_Hs01_00169420 predicted 2407
10 SASI_Hs01_00169421 predicted 2163
11 SASI_Hs01_00169422 predicted 2306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073565 predicted 1288
2 SASI_Rn01_00073566 predicted 957
3 SASI_Rn01_00073567 predicted 1592
4 SASI_Rn01_00073568 predicted 1529
5 SASI_Rn02_00203893 predicted 1296
6 SASI_Rn01_00073569 predicted 1512
7 SASI_Rn01_00073571 predicted 1483
8 SASI_Rn01_00073572 predicted 1036
9 SASI_Rn02_00203894 predicted 1412
10 SASI_Rn01_00073574 predicted 1704
11 SASI_Rn01_00073570 predicted 1388
12 SASI_Rn01_00073573 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057831 predicted 1307
2 SASI_Rn01_00057832 predicted 972
3 SASI_Rn01_00057833 predicted 1610
4 SASI_Rn01_00057834 predicted 1546
5 SASI_Rn02_00260414 predicted 1312
6 SASI_Rn01_00057835 predicted 1532
7 SASI_Rn01_00057837 predicted 1500
8 SASI_Rn01_00057838 predicted 1044
9 SASI_Rn02_00260415 predicted 1430
10 SASI_Rn01_00057840 predicted 1721
11 SASI_Rn01_00057836 predicted 1397
12 SASI_Rn01_00057839 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289072 predicted 1862
2 SASI_Mm01_00179284 predicted 1402
3 SASI_Mm02_00289073 predicted 1997
4 SASI_Mm01_00179286 predicted 1590
5 SASI_Mm02_00289074 predicted 1470
6 SASI_Mm01_00179288 predicted 1372
7 SASI_Mm01_00179289 predicted 1652
8 SASI_Mm01_00179290 predicted 1574
9 SASI_Mm02_00289075 predicted 1167
10 SASI_Mm02_00289076 predicted 1436
11 SASI_Mm01_00179281 predicted 1033
12 SASI_Mm01_00179282 predicted 1524
13 SASI_Mm01_00179283 predicted 1419
14 SASI_Mm01_00179285 predicted 1456
15 SASI_Mm01_00179287 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311487 predicted 2243
2 SASI_Mm01_00105316 predicted 1787
3 SASI_Mm02_00311488 predicted 2380
4 SASI_Mm01_00105318 predicted 1966
5 SASI_Mm02_00311489 predicted 1848
6 SASI_Mm01_00105320 predicted 1757
7 SASI_Mm01_00105321 predicted 2036
8 SASI_Mm01_00105322 predicted 1957
9 SASI_Mm02_00311490 predicted 1544
10 SASI_Mm02_00311491 predicted 1816
11 SASI_Mm01_00105313 predicted 1400
12 SASI_Mm01_00105314 predicted 1888
13 SASI_Mm01_00105315 predicted 1782
14 SASI_Mm01_00105317 predicted 1825
15 SASI_Mm01_00105319 predicted 1476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001094
ASIC2 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001094.4-974s21c1
Sequence:CCGGGAGACAGAGGAAACGACATTTCTCGAGAAATGTCGTTTCCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001094.4-1644s21c1
Sequence:CCGGTGATCAAAGAGAAGCTATTAGCTCGAGCTAATAGCTTCTCTTTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1505s1c1
Sequence:CCGGGCTCTCAATTATGAGACAATTCTCGAGAATTGTCTCATAATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-314s1c1
Sequence:CCGGCCTTCTAGCATCCAGATCTTTCTCGAGAAAGATCTGGATGCTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1424s1c1
Sequence:CCGGGCCAAGTACCTTGAGAAGAAACTCGAGTTTCTTCTCAAGGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-814s1c1
Sequence:CCGGCCAAGACTTCACCACAGTGTTCTCGAGAACACTGTGGTGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1550s1c1
Sequence:CCGGGCTGCCTTACTTGGTGATATTCTCGAGAATATCACCAAGTAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001094
ASIC2 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001094.4-974s21c1
Sequence:CCGGGAGACAGAGGAAACGACATTTCTCGAGAAATGTCGTTTCCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001094.4-1644s21c1
Sequence:CCGGTGATCAAAGAGAAGCTATTAGCTCGAGCTAATAGCTTCTCTTTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1505s1c1
Sequence:CCGGGCTCTCAATTATGAGACAATTCTCGAGAATTGTCTCATAATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-314s1c1
Sequence:CCGGCCTTCTAGCATCCAGATCTTTCTCGAGAAAGATCTGGATGCTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1424s1c1
Sequence:CCGGGCCAAGTACCTTGAGAAGAAACTCGAGTTTCTTCTCAAGGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-814s1c1
Sequence:CCGGCCAAGACTTCACCACAGTGTTCTCGAGAACACTGTGGTGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1550s1c1
Sequence:CCGGGCTGCCTTACTTGGTGATATTCTCGAGAATATCACCAAGTAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001094
ASIC2 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001094.4-974s21c1
Sequence:CCGGGAGACAGAGGAAACGACATTTCTCGAGAAATGTCGTTTCCTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001094.4-1644s21c1
Sequence:CCGGTGATCAAAGAGAAGCTATTAGCTCGAGCTAATAGCTTCTCTTTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1505s1c1
Sequence:CCGGGCTCTCAATTATGAGACAATTCTCGAGAATTGTCTCATAATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-314s1c1
Sequence:CCGGCCTTCTAGCATCCAGATCTTTCTCGAGAAAGATCTGGATGCTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1424s1c1
Sequence:CCGGGCCAAGTACCTTGAGAAGAAACTCGAGTTTCTTCTCAAGGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-814s1c1
Sequence:CCGGCCAAGACTTCACCACAGTGTTCTCGAGAACACTGTGGTGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001094.4-1550s1c1
Sequence:CCGGGCTGCCTTACTTGGTGATATTCTCGAGAATATCACCAAGTAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007384
ASIC2 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1822s1c1
Sequence:CCGGGCGCTCAATTACGAGACAATTCTCGAGAATTGTCTCGTAATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1855s1c1
Sequence:CCGGGCGTATGAAGTTGCTGCCTTACTCGAGTAAGGCAGCAACTTCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1915s1c1
Sequence:CCGGGCTAGTATCCTTACAATACTACTCGAGTAGTATTGTAAGGATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-614s1c1
Sequence:CCGGCGTCCCTGAGTCGCACTAAATCTCGAGATTTAGTGCGACTCAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-759s1c1
Sequence:CCGGCCTGCTCTACTGGCTCAGTTTCTCGAGAAACTGAGCCAGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007384
ASIC2 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1822s1c1
Sequence:CCGGGCGCTCAATTACGAGACAATTCTCGAGAATTGTCTCGTAATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1855s1c1
Sequence:CCGGGCGTATGAAGTTGCTGCCTTACTCGAGTAAGGCAGCAACTTCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1915s1c1
Sequence:CCGGGCTAGTATCCTTACAATACTACTCGAGTAGTATTGTAAGGATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-614s1c1
Sequence:CCGGCGTCCCTGAGTCGCACTAAATCTCGAGATTTAGTGCGACTCAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-759s1c1
Sequence:CCGGCCTGCTCTACTGGCTCAGTTTCTCGAGAAACTGAGCCAGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007384
ASIC2 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1822s1c1
Sequence:CCGGGCGCTCAATTACGAGACAATTCTCGAGAATTGTCTCGTAATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1855s1c1
Sequence:CCGGGCGTATGAAGTTGCTGCCTTACTCGAGTAAGGCAGCAACTTCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-1915s1c1
Sequence:CCGGGCTAGTATCCTTACAATACTACTCGAGTAGTATTGTAAGGATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-614s1c1
Sequence:CCGGCGTCCCTGAGTCGCACTAAATCTCGAGATTTAGTGCGACTCAGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007384.1-759s1c1
Sequence:CCGGCCTGCTCTACTGGCTCAGTTTCTCGAGAAACTGAGCCAGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks