EMAIL THIS PAGE TO A FRIEND

ASIC3

acid-sensing (proton-gated) ion channel 3

137 Gene Product Result for
Synonyms: ACCN3 DRASIC SLNAC1 TNaC1
Gene ID:
Human(9311) Summary: This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 2 has been observed as proton-gated channels sensitive to gadolinium. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
Mouse(171209) acid-sensing (proton-gated) ion channel 3
Rat(286920) acid-sensing (proton-gated) ion channel 3
naked mole-rat(101722725) acid-sensing (proton-gated) ion channel 3
domestic guinea pig(100731464) acid-sensing (proton-gated) ion channel 3
sheep(101113062) acid-sensing (proton-gated) ion channel 3
domestic cat(101096970) acid-sensing (proton-gated) ion channel 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004769 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU173471 MISSION® esiRNA esiRNA targeting mouse Accn3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004769 Rosetta Predictions human pricing
NM_020321 Rosetta Predictions human pricing
NM_020322 Rosetta Predictions human pricing
NM_173135 Rosetta Predictions rat pricing
NM_183000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124189 predicted 884
2 SASI_Hs01_00124190 predicted 627
3 SASI_Hs01_00124191 predicted 787
4 SASI_Hs02_00338272 predicted 547
5 SASI_Hs01_00124192 predicted 1027
6 SASI_Hs01_00124193 predicted 1035
7 SASI_Hs02_00338273 predicted 413
8 SASI_Hs01_00124194 predicted 555
9 SASI_Hs01_00124195 predicted 599
10 SASI_Hs01_00124196 predicted 917
11 SASI_Hs01_00124197 predicted 456
12 SASI_Hs01_00124198 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198167 predicted 884
2 SASI_Hs01_00198168 predicted 627
3 SASI_Hs01_00198169 predicted 787
4 SASI_Hs02_00353247 predicted 544
5 SASI_Hs01_00198170 predicted 1026
6 SASI_Hs01_00198171 predicted 1032
7 SASI_Hs02_00353248 predicted 421
8 SASI_Hs01_00198172 predicted 554
9 SASI_Hs01_00198173 predicted 597
10 SASI_Hs01_00198174 predicted 919
11 SASI_Hs01_00198175 predicted 456
12 SASI_Hs01_00198176 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052278 predicted 885
2 SASI_Hs01_00052279 predicted 623
3 SASI_Hs01_00052280 predicted 793
4 SASI_Hs02_00353249 predicted 549
5 SASI_Hs01_00052281 predicted 1030
6 SASI_Hs01_00052282 predicted 1032
7 SASI_Hs02_00353250 predicted 422
8 SASI_Hs01_00052283 predicted 552
9 SASI_Hs01_00052284 predicted 599
10 SASI_Hs01_00052285 predicted 915
11 SASI_Hs01_00052286 predicted 457
12 SASI_Hs01_00052287 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106661 predicted 258
2 SASI_Rn01_00106662 predicted 1217
3 SASI_Rn01_00106663 predicted 1113
4 SASI_Rn01_00106664 predicted 1172
5 SASI_Rn01_00106665 predicted 474
6 SASI_Rn01_00106666 predicted 922
7 SASI_Rn01_00106667 predicted 429
8 SASI_Rn01_00106668 predicted 625
9 SASI_Rn01_00106669 predicted 976
10 SASI_Rn01_00106670 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350009 predicted 1533
2 SASI_Mm01_00059987 predicted 333
3 SASI_Mm02_00350010 predicted 1241
4 SASI_Mm02_00350011 predicted 1231
5 SASI_Mm02_00350012 predicted 1426
6 SASI_Mm01_00059989 predicted 522
7 SASI_Mm01_00059990 predicted 772
8 SASI_Mm02_00350013 predicted 1620
9 SASI_Mm02_00350014 predicted 1549
10 SASI_Mm01_00059991 predicted 309
11 SASI_Mm01_00059986 predicted 678
12 SASI_Mm01_00059988 predicted 1494
13 SASI_Mm01_00059992 predicted 1448
14 SASI_Mm01_00059993 predicted 576
15 SASI_Mm01_00059994 predicted 1275
16 SASI_Mm01_00059995 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004769
ASIC3 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-1305s1c1
Sequence:CCGGGAAGGCCTATGAGATGTCAGACTCGAGTCTGACATCTCATAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-1392s1c1
Sequence:CCGGGATCCTAGACTACCTCTGTGACTCGAGTCACAGAGGTAGTCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-806s1c1
Sequence:CCGGGCTACCAGACCTTTGTTTCTTCTCGAGAAGAAACAAAGGTCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-1011s21c1
Sequence:CCGGGACGTGCAGCAGGAGGAATATCTCGAGATATTCCTCCTGCTGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.2-799s1c1
Sequence:CCGGTTGACATGGCGCAACTCTATGCTCGAGCATAGAGTTGCGCCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.2-1764s1c1
Sequence:CCGGGACAAGGTCCTGGGATATTTCCTCGAGGAAATATCCCAGGACCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-888s21c1
Sequence:CCGGGAGAACTTCACCACGATCTTCCTCGAGGAAGATCGTGGTGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-916s21c1
Sequence:CCGGTGGGAAAGTGCTACACATTTACTCGAGTAAATGTGTAGCACTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004769
ASIC3 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-1305s1c1
Sequence:CCGGGAAGGCCTATGAGATGTCAGACTCGAGTCTGACATCTCATAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-1392s1c1
Sequence:CCGGGATCCTAGACTACCTCTGTGACTCGAGTCACAGAGGTAGTCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-806s1c1
Sequence:CCGGGCTACCAGACCTTTGTTTCTTCTCGAGAAGAAACAAAGGTCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-1011s21c1
Sequence:CCGGGACGTGCAGCAGGAGGAATATCTCGAGATATTCCTCCTGCTGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.2-799s1c1
Sequence:CCGGTTGACATGGCGCAACTCTATGCTCGAGCATAGAGTTGCGCCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.2-1764s1c1
Sequence:CCGGGACAAGGTCCTGGGATATTTCCTCGAGGAAATATCCCAGGACCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-888s21c1
Sequence:CCGGGAGAACTTCACCACGATCTTCCTCGAGGAAGATCGTGGTGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-916s21c1
Sequence:CCGGTGGGAAAGTGCTACACATTTACTCGAGTAAATGTGTAGCACTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004769
ASIC3 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-1305s1c1
Sequence:CCGGGAAGGCCTATGAGATGTCAGACTCGAGTCTGACATCTCATAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-1392s1c1
Sequence:CCGGGATCCTAGACTACCTCTGTGACTCGAGTCACAGAGGTAGTCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.1-806s1c1
Sequence:CCGGGCTACCAGACCTTTGTTTCTTCTCGAGAAGAAACAAAGGTCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-1011s21c1
Sequence:CCGGGACGTGCAGCAGGAGGAATATCTCGAGATATTCCTCCTGCTGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.2-799s1c1
Sequence:CCGGTTGACATGGCGCAACTCTATGCTCGAGCATAGAGTTGCGCCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004769.2-1764s1c1
Sequence:CCGGGACAAGGTCCTGGGATATTTCCTCGAGGAAATATCCCAGGACCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-888s21c1
Sequence:CCGGGAGAACTTCACCACGATCTTCCTCGAGGAAGATCGTGGTGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004769.2-916s21c1
Sequence:CCGGTGGGAAAGTGCTACACATTTACTCGAGTAAATGTGTAGCACTTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183000
ASIC3 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183000.1-816s1c1
Sequence:CCGGGCAATGCTACACCTTCAACTCCTCGAGGAGTTGAAGGTGTAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183000.1-1728s1c1
Sequence:CCGGGAGACTTACATCACGGAGAATCTCGAGATTCTCCGTGATGTAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183000.1-782s1c1
Sequence:CCGGCTGAGAACTTCACAGTGATTTCTCGAGAAATCACTGTGAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-883s21c1
Sequence:CCGGGGCAATGGACTGGAGATTATGCTCGAGCATAATCTCCAGTCCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1118s21c1
Sequence:CCGGCATCTGTGGATCCCGACTTTGCTCGAGCAAAGTCGGGATCCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1176s21c1
Sequence:CCGGCAGCCCTCCTTATAGCTTAATCTCGAGATTAAGCTATAAGGAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1242s21c1
Sequence:CCGGCGGATGTCGAATGATGCATATCTCGAGATATGCATCATTCGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1460s21c1
Sequence:CCGGAGACTTACATCACGGAGAATGCTCGAGCATTCTCCGTGATGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183000
ASIC3 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183000.1-816s1c1
Sequence:CCGGGCAATGCTACACCTTCAACTCCTCGAGGAGTTGAAGGTGTAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183000.1-1728s1c1
Sequence:CCGGGAGACTTACATCACGGAGAATCTCGAGATTCTCCGTGATGTAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183000.1-782s1c1
Sequence:CCGGCTGAGAACTTCACAGTGATTTCTCGAGAAATCACTGTGAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-883s21c1
Sequence:CCGGGGCAATGGACTGGAGATTATGCTCGAGCATAATCTCCAGTCCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1118s21c1
Sequence:CCGGCATCTGTGGATCCCGACTTTGCTCGAGCAAAGTCGGGATCCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1176s21c1
Sequence:CCGGCAGCCCTCCTTATAGCTTAATCTCGAGATTAAGCTATAAGGAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1242s21c1
Sequence:CCGGCGGATGTCGAATGATGCATATCTCGAGATATGCATCATTCGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1460s21c1
Sequence:CCGGAGACTTACATCACGGAGAATGCTCGAGCATTCTCCGTGATGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183000
ASIC3 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183000.1-816s1c1
Sequence:CCGGGCAATGCTACACCTTCAACTCCTCGAGGAGTTGAAGGTGTAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183000.1-1728s1c1
Sequence:CCGGGAGACTTACATCACGGAGAATCTCGAGATTCTCCGTGATGTAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183000.1-782s1c1
Sequence:CCGGCTGAGAACTTCACAGTGATTTCTCGAGAAATCACTGTGAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-883s21c1
Sequence:CCGGGGCAATGGACTGGAGATTATGCTCGAGCATAATCTCCAGTCCATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1118s21c1
Sequence:CCGGCATCTGTGGATCCCGACTTTGCTCGAGCAAAGTCGGGATCCACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1176s21c1
Sequence:CCGGCAGCCCTCCTTATAGCTTAATCTCGAGATTAAGCTATAAGGAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1242s21c1
Sequence:CCGGCGGATGTCGAATGATGCATATCTCGAGATATGCATCATTCGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183000.2-1460s21c1
Sequence:CCGGAGACTTACATCACGGAGAATGCTCGAGCATTCTCCGTGATGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks