EMAIL THIS PAGE TO A FRIEND

ASIC4

acid-sensing (proton-gated) ion channel family member 4

105 Gene Product Result for
Synonyms: ACCN4 BNAC4
UniProtKB ID: Q96FT7, Q53SB7, Q6GMS1, Q6PIN9, Q9NQA4
Gene ID:
Human(55515) Summary: This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
Mouse(241118) acid-sensing (proton-gated) ion channel family member 4
Rat(63882) acid-sensing (proton-gated) ion channel family member 4
chicken(769191) acid-sensing (proton-gated) ion channel family member 4
cow(100848162) acid-sensing (proton-gated) ion channel family member 4
domestic cat(101097509) acid-sensing (proton-gated) ion channel family member 4
sheep(101113830) acid-sensing (proton-gated) ion channel family member 4
domestic guinea pig(100732638) acid-sensing (proton-gated) ion channel family member 4
naked mole-rat(101712702) acid-sensing (proton-gated) ion channel family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156921 MISSION® esiRNA esiRNA human ACCN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018674 Rosetta Predictions human pricing
NM_182847 Rosetta Predictions human pricing
NM_022234 Rosetta Predictions rat pricing
NM_183022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079220 predicted 1103
2 SASI_Hs01_00079221 predicted 872
3 SASI_Hs01_00079222 predicted 1100
4 SASI_Hs01_00079223 predicted 1126
5 SASI_Hs01_00079224 predicted 1140
6 SASI_Hs01_00079225 predicted 918
7 SASI_Hs01_00079226 predicted 970
8 SASI_Hs01_00079227 predicted 1128
9 SASI_Hs01_00079228 predicted 2009
10 SASI_Hs01_00079229 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225755 predicted 1094
2 SASI_Hs01_00225756 predicted 864
3 SASI_Hs01_00225757 predicted 1100
4 SASI_Hs01_00225758 predicted 1124
5 SASI_Hs01_00225759 predicted 1132
6 SASI_Hs01_00225760 predicted 916
7 SASI_Hs01_00225761 predicted 975
8 SASI_Hs01_00225762 predicted 1128
9 SASI_Hs01_00225763 predicted 1949
10 SASI_Hs01_00225764 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263001 predicted 1443
2 SASI_Rn02_00263002 predicted 1806
3 SASI_Rn02_00263003 predicted 888
4 SASI_Rn02_00263004 predicted 1018
5 SASI_Rn01_00117936 predicted 783
6 SASI_Rn01_00117938 predicted 913
7 SASI_Rn01_00117941 predicted 1641
8 SASI_Rn02_00263005 predicted 909
9 SASI_Rn02_00263006 predicted 912
10 SASI_Rn02_00263007 predicted 891
11 SASI_Rn01_00117932 predicted 1143
12 SASI_Rn01_00117933 predicted 1509
13 SASI_Rn01_00117934 predicted 874
14 SASI_Rn01_00117935 predicted 1325
15 SASI_Rn01_00117937 predicted 991
16 SASI_Rn01_00117939 predicted 632
17 SASI_Rn01_00117940 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031153 predicted 1957
2 SASI_Mm01_00031154 predicted 1533
3 SASI_Mm01_00031155 predicted 842
4 SASI_Mm01_00031156 predicted 1502
5 SASI_Mm01_00031157 predicted 1923
6 SASI_Mm01_00031158 predicted 1352
7 SASI_Mm01_00031159 predicted 1022
8 SASI_Mm01_00031160 predicted 799
9 SASI_Mm01_00031161 predicted 1654
10 SASI_Mm01_00031162 predicted 1508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018674
ASIC4 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel family member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-1289s21c1
Sequence:CCGGCGTCGTTTGAGGCAGGTATTCCTCGAGGAATACCTGCCTCAAACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-1581s21c1
Sequence:CCGGGACCATCTGCCCACCAAATATCTCGAGATATTTGGTGGGCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-936s21c1
Sequence:CCGGACTCAGCGATGCCGACATCTTCTCGAGAAGATGTCGGCATCGCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-399s1c1
Sequence:CCGGCCGATCGAGATTGTGTGCAAACTCGAGTTTGCACACAATCTCGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-917s1c1
Sequence:CCGGCGACATGCTTAAGAGCTGCAACTCGAGTTGCAGCTCTTAAGCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018674.3-2170s1c1
Sequence:CCGGGCTTTGCACAAAGGTCCTTCTCTCGAGAGAAGGACCTTTGTGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-1526s1c1
Sequence:CCGGGACACGCTATGGGAAAGAGATCTCGAGATCTCTTTCCCATAGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-743s1c1
Sequence:CCGGCCTCTGCAATATCAACCGCTTCTCGAGAAGCGGTTGATATTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018674
ASIC4 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel family member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-1289s21c1
Sequence:CCGGCGTCGTTTGAGGCAGGTATTCCTCGAGGAATACCTGCCTCAAACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-1581s21c1
Sequence:CCGGGACCATCTGCCCACCAAATATCTCGAGATATTTGGTGGGCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-936s21c1
Sequence:CCGGACTCAGCGATGCCGACATCTTCTCGAGAAGATGTCGGCATCGCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-399s1c1
Sequence:CCGGCCGATCGAGATTGTGTGCAAACTCGAGTTTGCACACAATCTCGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-917s1c1
Sequence:CCGGCGACATGCTTAAGAGCTGCAACTCGAGTTGCAGCTCTTAAGCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018674.3-2170s1c1
Sequence:CCGGGCTTTGCACAAAGGTCCTTCTCTCGAGAGAAGGACCTTTGTGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-1526s1c1
Sequence:CCGGGACACGCTATGGGAAAGAGATCTCGAGATCTCTTTCCCATAGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-743s1c1
Sequence:CCGGCCTCTGCAATATCAACCGCTTCTCGAGAAGCGGTTGATATTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018674
ASIC4 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel family member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-1289s21c1
Sequence:CCGGCGTCGTTTGAGGCAGGTATTCCTCGAGGAATACCTGCCTCAAACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-1581s21c1
Sequence:CCGGGACCATCTGCCCACCAAATATCTCGAGATATTTGGTGGGCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018674.4-936s21c1
Sequence:CCGGACTCAGCGATGCCGACATCTTCTCGAGAAGATGTCGGCATCGCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-399s1c1
Sequence:CCGGCCGATCGAGATTGTGTGCAAACTCGAGTTTGCACACAATCTCGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-917s1c1
Sequence:CCGGCGACATGCTTAAGAGCTGCAACTCGAGTTGCAGCTCTTAAGCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018674.3-2170s1c1
Sequence:CCGGGCTTTGCACAAAGGTCCTTCTCTCGAGAGAAGGACCTTTGTGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-1526s1c1
Sequence:CCGGGACACGCTATGGGAAAGAGATCTCGAGATCTCTTTCCCATAGCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018674.3-743s1c1
Sequence:CCGGCCTCTGCAATATCAACCGCTTCTCGAGAAGCGGTTGATATTGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183022
ASIC4 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel family member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1017s21c1
Sequence:CCGGAGGAGGAATACCTACCCATATCTCGAGATATGGGTAGGTATTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1043s21c1
Sequence:CCGGGAGACAAACGAGACGTCATTCCTCGAGGAATGACGTCTCGTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-918s21c1
Sequence:CCGGATGGGAAGTGTTACACCTTTACTCGAGTAAAGGTGTAACACTTCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1656s21c1
Sequence:CCGGGACAGATGGGCCTGTTCATTGCTCGAGCAATGAACAGGCCCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183022.3-2334s21c1
Sequence:CCGGAGTCAGGGTCCTAGCCCTAATCTCGAGATTAGGGCTAGGACCCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1346s21c1
Sequence:CCGGGAGACCATCTGCCCACCAAATCTCGAGATTTGGTGGGCAGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-527s1c1
Sequence:CCGGGATATCTTCCACCTGGCCAATCTCGAGATTGGCCAGGTGGAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1328s1c1
Sequence:CCGGGCAAGGAAGTACAACCGCAATCTCGAGATTGCGGTTGTACTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1513s1c1
Sequence:CCGGGATCCTTGACTACATCTATGACTCGAGTCATAGATGTAGTCAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1732s1c1
Sequence:CCGGCTTTGAAGACTTTGCTTGCTACTCGAGTAGCAAGCAAAGTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183022
ASIC4 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel family member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1017s21c1
Sequence:CCGGAGGAGGAATACCTACCCATATCTCGAGATATGGGTAGGTATTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1043s21c1
Sequence:CCGGGAGACAAACGAGACGTCATTCCTCGAGGAATGACGTCTCGTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-918s21c1
Sequence:CCGGATGGGAAGTGTTACACCTTTACTCGAGTAAAGGTGTAACACTTCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1656s21c1
Sequence:CCGGGACAGATGGGCCTGTTCATTGCTCGAGCAATGAACAGGCCCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183022.3-2334s21c1
Sequence:CCGGAGTCAGGGTCCTAGCCCTAATCTCGAGATTAGGGCTAGGACCCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1346s21c1
Sequence:CCGGGAGACCATCTGCCCACCAAATCTCGAGATTTGGTGGGCAGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-527s1c1
Sequence:CCGGGATATCTTCCACCTGGCCAATCTCGAGATTGGCCAGGTGGAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1328s1c1
Sequence:CCGGGCAAGGAAGTACAACCGCAATCTCGAGATTGCGGTTGTACTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1513s1c1
Sequence:CCGGGATCCTTGACTACATCTATGACTCGAGTCATAGATGTAGTCAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1732s1c1
Sequence:CCGGCTTTGAAGACTTTGCTTGCTACTCGAGTAGCAAGCAAAGTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183022
ASIC4 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel family member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1017s21c1
Sequence:CCGGAGGAGGAATACCTACCCATATCTCGAGATATGGGTAGGTATTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1043s21c1
Sequence:CCGGGAGACAAACGAGACGTCATTCCTCGAGGAATGACGTCTCGTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-918s21c1
Sequence:CCGGATGGGAAGTGTTACACCTTTACTCGAGTAAAGGTGTAACACTTCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1656s21c1
Sequence:CCGGGACAGATGGGCCTGTTCATTGCTCGAGCAATGAACAGGCCCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183022.3-2334s21c1
Sequence:CCGGAGTCAGGGTCCTAGCCCTAATCTCGAGATTAGGGCTAGGACCCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183022.3-1346s21c1
Sequence:CCGGGAGACCATCTGCCCACCAAATCTCGAGATTTGGTGGGCAGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-527s1c1
Sequence:CCGGGATATCTTCCACCTGGCCAATCTCGAGATTGGCCAGGTGGAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1328s1c1
Sequence:CCGGGCAAGGAAGTACAACCGCAATCTCGAGATTGCGGTTGTACTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1513s1c1
Sequence:CCGGGATCCTTGACTACATCTATGACTCGAGTCATAGATGTAGTCAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183022.1-1732s1c1
Sequence:CCGGCTTTGAAGACTTTGCTTGCTACTCGAGTAGCAAGCAAAGTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks