EMAIL THIS PAGE TO A FRIEND

ASIC5

acid-sensing (proton-gated) ion channel family member 5

53 Gene Product Result for
Synonyms: ACCN5 HINAC INAC
UniProtKB ID: Q9NY37
Gene ID:
Human(51802) Summary: This gene belongs to the amiloride-sensitive Na+ channel and degenerin (NaC/DEG) family, members of which have been identified in many animal species ranging from the nematode to human. The amiloride-sensitive Na(+) channel encoded by this gene is primarily expressed in the small intestine, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Mouse(58170) acid-sensing (proton-gated) ion channel family member 5
Rat(63866) acid-sensing (proton-gated) ion channel family member 5
chicken(428723) acid-sensing (proton-gated) ion channel family member 5
domestic cat(101091190) acid-sensing (proton-gated) ion channel family member 5
dog(482664) acid-sensing (proton-gated) ion channel family member 5
naked mole-rat(101712150) acid-sensing (proton-gated) ion channel family member 5
domestic guinea pig(100727990) acid-sensing (proton-gated) ion channel family member 5
sheep(101113103) acid-sensing (proton-gated) ion channel family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017419 Rosetta Predictions human pricing
NM_022227 Rosetta Predictions rat pricing
NM_021370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349986 predicted 1409
2 SASI_Hs01_00047411 predicted 1129
3 SASI_Hs01_00047412 predicted 480
4 SASI_Hs01_00047413 predicted 638
5 SASI_Hs01_00047414 predicted 833
6 SASI_Hs02_00349987 predicted 800
7 SASI_Hs01_00047416 predicted 645
8 SASI_Hs01_00047417 predicted 467
9 SASI_Hs02_00349988 predicted 392
10 SASI_Hs01_00047418 predicted 585
11 SASI_Hs01_00047410 predicted 1123
12 SASI_Hs01_00047415 predicted 891
13 SASI_Hs01_00047419 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070281 predicted 410
2 SASI_Rn01_00070282 predicted 1463
3 SASI_Rn01_00070283 predicted 1445
4 SASI_Rn01_00070284 predicted 441
5 SASI_Rn01_00070286 predicted 689
6 SASI_Rn01_00070287 predicted 1341
7 SASI_Rn01_00070288 predicted 1650
8 SASI_Rn01_00070289 predicted 1453
9 SASI_Rn02_00262991 predicted 977
10 SASI_Rn02_00262992 predicted 511
11 SASI_Rn01_00070280 predicted 1615
12 SASI_Rn01_00070285 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113810 predicted 1388
2 SASI_Mm01_00113811 predicted 980
3 SASI_Mm01_00113812 predicted 603
4 SASI_Mm01_00113814 predicted 374
5 SASI_Mm01_00113815 predicted 1282
6 SASI_Mm01_00113816 predicted 615
7 SASI_Mm01_00113817 predicted 606
8 SASI_Mm01_00113818 predicted 389
9 SASI_Mm01_00113819 predicted 628
10 SASI_Mm02_00325959 predicted 388
11 SASI_Mm01_00113813 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017419
ASIC5 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel family member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017419.1-546s1c1
Sequence:CCGGGTGGAATTTATCAGGAACAAACTCGAGTTTGTTCCTGATAAATTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-899s1c1
Sequence:CCGGCCAAGTGAAGACAGTTCATCACTCGAGTGATGAACTGTCTTCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-144s1c1
Sequence:CCGGGAGCGAAAGAAGTTTGACCATCTCGAGATGGTCAAACTTCTTTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-295s1c1
Sequence:CCGGGCTTGCTCAACTACTTCACATCTCGAGATGTGAAGTAGTTGAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-325s1c1
Sequence:CCGGCAACGTCCATTGAGGTTCAATCTCGAGATTGAACCTCAATGGACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-411s21c1
Sequence:CCGGGTAGCCAAATTTGGTGTTATTCTCGAGAATAACACCAAATTTGGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-1108s21c1
Sequence:CCGGTACTTGACCACATTGAATTTACTCGAGTAAATTCAATGTGGTCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-1256s21c1
Sequence:CCGGGTTGAATCAAAGCCGGAAATACTCGAGTATTTCCGGCTTTGATTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-76s21c1
Sequence:CCGGATGCTGAGAACGGACTCTTAGCTCGAGCTAAGAGTCCGTTCTCAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017419
ASIC5 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel family member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017419.1-546s1c1
Sequence:CCGGGTGGAATTTATCAGGAACAAACTCGAGTTTGTTCCTGATAAATTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-899s1c1
Sequence:CCGGCCAAGTGAAGACAGTTCATCACTCGAGTGATGAACTGTCTTCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-144s1c1
Sequence:CCGGGAGCGAAAGAAGTTTGACCATCTCGAGATGGTCAAACTTCTTTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-295s1c1
Sequence:CCGGGCTTGCTCAACTACTTCACATCTCGAGATGTGAAGTAGTTGAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-325s1c1
Sequence:CCGGCAACGTCCATTGAGGTTCAATCTCGAGATTGAACCTCAATGGACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-411s21c1
Sequence:CCGGGTAGCCAAATTTGGTGTTATTCTCGAGAATAACACCAAATTTGGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-1108s21c1
Sequence:CCGGTACTTGACCACATTGAATTTACTCGAGTAAATTCAATGTGGTCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-1256s21c1
Sequence:CCGGGTTGAATCAAAGCCGGAAATACTCGAGTATTTCCGGCTTTGATTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-76s21c1
Sequence:CCGGATGCTGAGAACGGACTCTTAGCTCGAGCTAAGAGTCCGTTCTCAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017419
ASIC5 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel family member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017419.1-546s1c1
Sequence:CCGGGTGGAATTTATCAGGAACAAACTCGAGTTTGTTCCTGATAAATTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-899s1c1
Sequence:CCGGCCAAGTGAAGACAGTTCATCACTCGAGTGATGAACTGTCTTCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-144s1c1
Sequence:CCGGGAGCGAAAGAAGTTTGACCATCTCGAGATGGTCAAACTTCTTTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-295s1c1
Sequence:CCGGGCTTGCTCAACTACTTCACATCTCGAGATGTGAAGTAGTTGAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017419.1-325s1c1
Sequence:CCGGCAACGTCCATTGAGGTTCAATCTCGAGATTGAACCTCAATGGACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-411s21c1
Sequence:CCGGGTAGCCAAATTTGGTGTTATTCTCGAGAATAACACCAAATTTGGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-1108s21c1
Sequence:CCGGTACTTGACCACATTGAATTTACTCGAGTAAATTCAATGTGGTCAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-1256s21c1
Sequence:CCGGGTTGAATCAAAGCCGGAAATACTCGAGTATTTCCGGCTTTGATTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017419.2-76s21c1
Sequence:CCGGATGCTGAGAACGGACTCTTAGCTCGAGCTAAGAGTCCGTTCTCAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021370
ASIC5 MISSION shRNA Bacterial Glycerol Stock
acid-sensing (proton-gated) ion channel family member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-937s1c1
Sequence:CCGGGCTGAGAAACTTCATTACCTACTCGAGTAGGTAATGAAGTTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-259s1c1
Sequence:CCGGGTGGCAAATCTACAGTCGTTTCTCGAGAAACGACTGTAGATTTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-790s1c1
Sequence:CCGGCTTTGTTATTCACTCACCAAACTCGAGTTTGGTGAGTGAATAACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-1343s1c1
Sequence:CCGGCCTGAGTTACTTGCAGATGTTCTCGAGAACATCTGCAAGTAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-1262s1c1
Sequence:CCGGCGGGAGAATCTCGTGAACATTCTCGAGAATGTTCACGAGATTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021370
ASIC5 MISSION shRNA shRNA Plasmid DNA
acid-sensing (proton-gated) ion channel family member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-937s1c1
Sequence:CCGGGCTGAGAAACTTCATTACCTACTCGAGTAGGTAATGAAGTTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-259s1c1
Sequence:CCGGGTGGCAAATCTACAGTCGTTTCTCGAGAAACGACTGTAGATTTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-790s1c1
Sequence:CCGGCTTTGTTATTCACTCACCAAACTCGAGTTTGGTGAGTGAATAACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-1343s1c1
Sequence:CCGGCCTGAGTTACTTGCAGATGTTCTCGAGAACATCTGCAAGTAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-1262s1c1
Sequence:CCGGCGGGAGAATCTCGTGAACATTCTCGAGAATGTTCACGAGATTCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021370
ASIC5 MISSION shRNA Lentiviral Transduction Particles
acid-sensing (proton-gated) ion channel family member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-937s1c1
Sequence:CCGGGCTGAGAAACTTCATTACCTACTCGAGTAGGTAATGAAGTTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-259s1c1
Sequence:CCGGGTGGCAAATCTACAGTCGTTTCTCGAGAAACGACTGTAGATTTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-790s1c1
Sequence:CCGGCTTTGTTATTCACTCACCAAACTCGAGTTTGGTGAGTGAATAACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-1343s1c1
Sequence:CCGGCCTGAGTTACTTGCAGATGTTCTCGAGAACATCTGCAAGTAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021370.1-1262s1c1
Sequence:CCGGCGGGAGAATCTCGTGAACATTCTCGAGAATGTTCACGAGATTCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)