EMAIL THIS PAGE TO A FRIEND

ASIP

agouti signaling protein

34 Gene Product Result for
Synonyms: AGSW AGTI AGTIL ASP SHEP9
UniProtKB ID: P42127, Q3SXL2
Gene ID:
Human(434) Summary: In mice, the agouti gene encodes a paracrine signaling molecule that causes hair follicle melanocytes to synthesize pheomelanin, a yellow pigment, instead of the black or brown pigment, eumelanin. Pleiotropic effects of constitutive expression of the mouse gene include adult-onset obesity, increased tumor susceptibility, and premature infertility. This gene is highly similar to the mouse gene and encodes a secreted protein that may (1) affect the quality of hair pigmentation, (2) act as a pharmacological antagonist of alpha-melanocyte-stimulating hormone, (3) play a role in neuroendocrine aspects of melanocortin action, and (4) have a functional role in regulating lipid metabolism in adipocytes. [provided by RefSeq, Jul 2008]
Rat(24152) agouti signaling protein
Zebrafish(798574) agouti signaling protein
cow(404192) agouti signaling protein
Horse(100054335) agouti signaling protein
chicken(419147) agouti signaling protein
domestic cat(492297) agouti signaling protein
dog(492296) agouti signaling protein
Goat(100860915) agouti signaling protein
Domestic Rabbit(100144328) agouti signaling protein
sheep(100127221) agouti signaling protein
domestic guinea pig(100721050) agouti signaling protein
naked mole-rat(101713451) agouti signaling protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001672 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001672 Rosetta Predictions human pricing
NM_052979 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332308 predicted 228
2 SASI_Hs01_00152953 predicted 283
3 SASI_Hs01_00152954 predicted 219
4 SASI_Hs01_00152955 predicted 223
5 SASI_Hs01_00152956 predicted 228
6 SASI_Hs01_00152957 predicted 230
7 SASI_Hs01_00152958 predicted 278
8 SASI_Hs01_00152959 predicted 536
9 SASI_Hs01_00152960 predicted 170
10 SASI_Hs01_00152961 predicted 122
11 SASI_Hs01_00152962 predicted 144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092354 predicted 252
2 SASI_Rn01_00092356 predicted 208
3 SASI_Rn01_00092358 predicted 191
4 SASI_Rn01_00092359 predicted 234
5 SASI_Rn01_00092360 predicted 200
6 SASI_Rn01_00092361 predicted 206
7 SASI_Rn01_00092362 predicted 211
8 SASI_Rn02_00265617 predicted 235
9 SASI_Rn02_00265618 predicted 234
10 SASI_Rn02_00265619 predicted 201
11 SASI_Rn01_00092353 predicted 230
12 SASI_Rn01_00092355 predicted 206
13 SASI_Rn01_00092357 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001672
ASIP MISSION shRNA Bacterial Glycerol Stock
agouti signaling protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-135s1c1
Sequence:CCGGTGAACCTACTGGATGTCCCTTCTCGAGAAGGGACATCCAGTAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-232s1c1
Sequence:CCGGGAAGGAGGCTTCGATGAAGAACTCGAGTTCTTCATCGAAGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-170s1c1
Sequence:CCGGGCGCTGAACAAGAAATCCAAACTCGAGTTTGGATTTCTTGTTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-222s1c1
Sequence:CCGGGATCTTCTAAGAAGGAGGCTTCTCGAGAAGCCTCCTTCTTAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-172s1c1
Sequence:CCGGGCTGAACAAGAAATCCAAACACTCGAGTGTTTGGATTTCTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001672
ASIP MISSION shRNA shRNA Plasmid DNA
agouti signaling protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-135s1c1
Sequence:CCGGTGAACCTACTGGATGTCCCTTCTCGAGAAGGGACATCCAGTAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-232s1c1
Sequence:CCGGGAAGGAGGCTTCGATGAAGAACTCGAGTTCTTCATCGAAGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-170s1c1
Sequence:CCGGGCGCTGAACAAGAAATCCAAACTCGAGTTTGGATTTCTTGTTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-222s1c1
Sequence:CCGGGATCTTCTAAGAAGGAGGCTTCTCGAGAAGCCTCCTTCTTAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-172s1c1
Sequence:CCGGGCTGAACAAGAAATCCAAACACTCGAGTGTTTGGATTTCTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001672
ASIP MISSION shRNA Lentiviral Transduction Particles
agouti signaling protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-135s1c1
Sequence:CCGGTGAACCTACTGGATGTCCCTTCTCGAGAAGGGACATCCAGTAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-232s1c1
Sequence:CCGGGAAGGAGGCTTCGATGAAGAACTCGAGTTCTTCATCGAAGCCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-170s1c1
Sequence:CCGGGCGCTGAACAAGAAATCCAAACTCGAGTTTGGATTTCTTGTTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-222s1c1
Sequence:CCGGGATCTTCTAAGAAGGAGGCTTCTCGAGAAGCCTCCTTCTTAGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001672.2-172s1c1
Sequence:CCGGGCTGAACAAGAAATCCAAACACTCGAGTGTTTGGATTTCTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks