EMAIL THIS PAGE TO A FRIEND

ASL

argininosuccinate lyase

86 Gene Product Result for
Synonyms: ASAL
UniProtKB ID: P04424, E7EMI0, E9PE48, Q6LDS5, Q96HS2
Gene ID:
Human(435) Summary: This gene encodes a member of the lyase 1 family. The encoded protein forms a cytosolic homotetramer and primarily catalyzes the reversible hydrolytic cleavage of argininosuccinate into arginine and fumarate, an essential step in the liver in detoxifying ammonia via the urea cycle. Mutations in this gene result in the autosomal recessive disorder argininosuccinic aciduria, or argininosuccinic acid lyase deficiency. A nontranscribed pseudogene is also located on the long arm of chromosome 22. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(109900) argininosuccinate lyase
Rat(59085) argininosuccinate lyase
Zebrafish(393423) argininosuccinate lyase
cow(512771) argininosuccinate lyase
Horse(100060801) argininosuccinate lyase
dog(479704) argininosuccinate lyase
fruit fly(40682) asterless
naked mole-rat(101709923) argininosuccinate lyase
Goat(100860854) argininosuccinate lyase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000048 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064821 MISSION® esiRNA esiRNA targeting mouse Asl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000048 Rosetta Predictions human pricing
NM_001024943 Rosetta Predictions human pricing
NM_001024944 Rosetta Predictions human pricing
NM_001024946 Rosetta Predictions human pricing
NM_021577 Rosetta Predictions rat pricing
NM_133768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119397 predicted 338
2 SASI_Hs01_00119398 predicted 1400
3 SASI_Hs01_00119399 predicted 289
4 SASI_Hs01_00119401 predicted 1290
5 SASI_Hs01_00119402 predicted 382
6 SASI_Hs01_00119403 predicted 290
7 SASI_Hs01_00119404 predicted 1319
8 SASI_Hs01_00119405 predicted 302
9 SASI_Hs01_00119406 predicted 1376
10 SASI_Hs02_00301743 predicted 396
11 SASI_Hs01_00119400 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232607 predicted 465
2 SASI_Hs01_00232608 predicted 1525
3 SASI_Hs01_00232609 predicted 412
4 SASI_Hs01_00232611 predicted 1412
5 SASI_Hs01_00232612 predicted 497
6 SASI_Hs01_00232613 predicted 417
7 SASI_Hs01_00232614 predicted 1440
8 SASI_Hs01_00232615 predicted 423
9 SASI_Hs01_00232616 predicted 1502
10 SASI_Hs02_00307275 predicted 513
11 SASI_Hs01_00232610 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042852 predicted 458
2 SASI_Hs01_00042853 predicted 1462
3 SASI_Hs01_00042854 predicted 416
4 SASI_Hs01_00042856 predicted 1355
5 SASI_Hs01_00042857 predicted 504
6 SASI_Hs01_00042858 predicted 414
7 SASI_Hs01_00042859 predicted 1380
8 SASI_Hs01_00042860 predicted 422
9 SASI_Hs01_00042861 predicted 1442
10 SASI_Hs02_00307276 predicted 519
11 SASI_Hs01_00042855 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233451 predicted 467
2 SASI_Hs01_00233452 predicted 1441
3 SASI_Hs01_00233453 predicted 417
4 SASI_Hs01_00233455 predicted 1337
5 SASI_Hs01_00233456 predicted 500
6 SASI_Hs01_00233457 predicted 417
7 SASI_Hs01_00233458 predicted 1366
8 SASI_Hs01_00233459 predicted 425
9 SASI_Hs01_00233460 predicted 1421
10 SASI_Hs02_00307277 predicted 511
11 SASI_Hs01_00233454 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262603 predicted 1187
2 SASI_Rn01_00063113 predicted 854
3 SASI_Rn01_00063114 predicted 1288
4 SASI_Rn01_00063115 predicted 1739
5 SASI_Rn01_00063116 predicted 1385
6 SASI_Rn01_00063117 predicted 1825
7 SASI_Rn01_00063118 predicted 1321
8 SASI_Rn01_00063119 predicted 1161
9 SASI_Rn01_00063120 predicted 1714
10 SASI_Rn01_00063122 predicted 862
11 SASI_Rn01_00063121 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039901 predicted 656
2 SASI_Mm01_00039902 predicted 870
3 SASI_Mm01_00039903 predicted 1201
4 SASI_Mm01_00039904 predicted 849
5 SASI_Mm01_00039905 predicted 1283
6 SASI_Mm01_00039906 predicted 556
7 SASI_Mm01_00039909 predicted 878
8 SASI_Mm01_00039910 predicted 619
9 SASI_Mm02_00338774 predicted 852
10 SASI_Mm02_00338775 predicted 1125
11 SASI_Mm01_00039907 predicted 1123
12 SASI_Mm01_00039908 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000048
VALIDATED
ASL MISSION shRNA Bacterial Glycerol Stock
argininosuccinate lyase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-182s1c1
Sequence:CCGGGTGGATGTTCAAGGCAGCAAACTCGAGTTTGCTGCCTTGAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-137s1c1
Sequence:CCGGGAGAAGTTCAACGCGTCCATTCTCGAGAATGGACGCGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-304s1c1
Sequence:CCGGCACCTTCAAACTGAACTCCAACTCGAGTTGGAGTTCAGTTTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-1052s1c1
Sequence:CCGGGAGGACAAGGAAGCTGTGTTTCTCGAGAAACACAGCTTCCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-1193s1c1
Sequence:CCGGGCCTATTACCTGGTCCGCAAACTCGAGTTTGCGGACCAGGTAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000048.3-1231s21c1
Sequence:CCGGGCCTATTACCTGGTCCGCAAACTCGAGTTTGCGGACCAGGTAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000048.3-220s21c1
Sequence:CCGGGTGGATGTTCAAGGCAGCAAACTCGAGTTTGCTGCCTTGAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000048.3-342s21c1
Sequence:CCGGCACCTTCAAACTGAACTCCAACTCGAGTTGGAGTTCAGTTTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000048.3-175s21c1
Sequence:CCGGGAGAAGTTCAACGCGTCCATTCTCGAGAATGGACGCGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000048
VALIDATED
ASL MISSION shRNA shRNA Plasmid DNA
argininosuccinate lyase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-182s1c1
Sequence:CCGGGTGGATGTTCAAGGCAGCAAACTCGAGTTTGCTGCCTTGAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-137s1c1
Sequence:CCGGGAGAAGTTCAACGCGTCCATTCTCGAGAATGGACGCGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-304s1c1
Sequence:CCGGCACCTTCAAACTGAACTCCAACTCGAGTTGGAGTTCAGTTTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-1052s1c1
Sequence:CCGGGAGGACAAGGAAGCTGTGTTTCTCGAGAAACACAGCTTCCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-1193s1c1
Sequence:CCGGGCCTATTACCTGGTCCGCAAACTCGAGTTTGCGGACCAGGTAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000048.3-1231s21c1
Sequence:CCGGGCCTATTACCTGGTCCGCAAACTCGAGTTTGCGGACCAGGTAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000048.3-220s21c1
Sequence:CCGGGTGGATGTTCAAGGCAGCAAACTCGAGTTTGCTGCCTTGAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000048.3-342s21c1
Sequence:CCGGCACCTTCAAACTGAACTCCAACTCGAGTTGGAGTTCAGTTTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000048.3-175s21c1
Sequence:CCGGGAGAAGTTCAACGCGTCCATTCTCGAGAATGGACGCGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000048
VALIDATED
ASL MISSION shRNA Lentiviral Transduction Particles
argininosuccinate lyase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-182s1c1
Sequence:CCGGGTGGATGTTCAAGGCAGCAAACTCGAGTTTGCTGCCTTGAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-137s1c1
Sequence:CCGGGAGAAGTTCAACGCGTCCATTCTCGAGAATGGACGCGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-304s1c1
Sequence:CCGGCACCTTCAAACTGAACTCCAACTCGAGTTGGAGTTCAGTTTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-1052s1c1
Sequence:CCGGGAGGACAAGGAAGCTGTGTTTCTCGAGAAACACAGCTTCCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000048.2-1193s1c1
Sequence:CCGGGCCTATTACCTGGTCCGCAAACTCGAGTTTGCGGACCAGGTAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000048.3-1231s21c1
Sequence:CCGGGCCTATTACCTGGTCCGCAAACTCGAGTTTGCGGACCAGGTAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_000048.3-220s21c1
Sequence:CCGGGTGGATGTTCAAGGCAGCAAACTCGAGTTTGCTGCCTTGAACATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000048.3-342s21c1
Sequence:CCGGCACCTTCAAACTGAACTCCAACTCGAGTTGGAGTTCAGTTTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000048.3-175s21c1
Sequence:CCGGGAGAAGTTCAACGCGTCCATTCTCGAGAATGGACGCGTTGAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133768
ASL MISSION shRNA Bacterial Glycerol Stock
argininosuccinate lyase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-311s1c1
Sequence:CCGGGCACCTTCAAATTACATCCTACTCGAGTAGGATGTAATTTGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-367s1c1
Sequence:CCGGCTGAAGGAACTCATCGGTGAACTCGAGTTCACCGATGAGTTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-1140s1c1
Sequence:CCGGGCAGATTCATCGTGAGAACATCTCGAGATGTTCTCACGATGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-1081s1c1
Sequence:CCGGGAAGTGTCTGACACCATGATACTCGAGTATCATGGTGTCAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-775s1c1
Sequence:CCGGGCCACCAGTGAGAGAGACTTTCTCGAGAAAGTCTCTCTCACTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133768
ASL MISSION shRNA shRNA Plasmid DNA
argininosuccinate lyase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-311s1c1
Sequence:CCGGGCACCTTCAAATTACATCCTACTCGAGTAGGATGTAATTTGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-367s1c1
Sequence:CCGGCTGAAGGAACTCATCGGTGAACTCGAGTTCACCGATGAGTTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-1140s1c1
Sequence:CCGGGCAGATTCATCGTGAGAACATCTCGAGATGTTCTCACGATGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-1081s1c1
Sequence:CCGGGAAGTGTCTGACACCATGATACTCGAGTATCATGGTGTCAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-775s1c1
Sequence:CCGGGCCACCAGTGAGAGAGACTTTCTCGAGAAAGTCTCTCTCACTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133768
ASL MISSION shRNA Lentiviral Transduction Particles
argininosuccinate lyase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-311s1c1
Sequence:CCGGGCACCTTCAAATTACATCCTACTCGAGTAGGATGTAATTTGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-367s1c1
Sequence:CCGGCTGAAGGAACTCATCGGTGAACTCGAGTTCACCGATGAGTTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-1140s1c1
Sequence:CCGGGCAGATTCATCGTGAGAACATCTCGAGATGTTCTCACGATGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-1081s1c1
Sequence:CCGGGAAGTGTCTGACACCATGATACTCGAGTATCATGGTGTCAGACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133768.1-775s1c1
Sequence:CCGGGCCACCAGTGAGAGAGACTTTCTCGAGAAAGTCTCTCTCACTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks