EMAIL THIS PAGE TO A FRIEND

ASMT

acetylserotonin O-methyltransferase

37 Gene Product Result for
Synonyms: ASMTY HIOMT HIOMTY
UniProtKB ID: P46597, B2RC33, Q16598, Q5JQ72, Q5JQ73
Gene ID:
Human(438) Summary: This gene belongs to the methyltransferase superfamily, and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin, and is abundant in the pineal gland. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Jan 2010]
Mouse(107626) acetylserotonin O-methyltransferase
Rat(246281) acetylserotonin O-methyltransferase
Zebrafish(100141344) acetylserotonin O-methyltransferase
domestic cat(101101365) acetylserotonin O-methyltransferase
cow(281013) acetylserotonin O-methyltransferase
chicken(396286) acetylserotonin O-methyltransferase
naked mole-rat(101697837) acetylserotonin O-methyltransferase
sheep(101114754) acetylserotonin O-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004043 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094351 MISSION® esiRNA esiRNA human ASMT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004043 Rosetta Predictions human pricing
NM_144759 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213948 predicted 415
2 SASI_Hs02_00336794 predicted 386
3 SASI_Hs01_00213949 predicted 439
4 SASI_Hs01_00213950 predicted 1046
5 SASI_Hs01_00213951 predicted 1022
6 SASI_Hs01_00213954 predicted 1028
7 SASI_Hs02_00336795 predicted 402
8 SASI_Hs02_00336796 predicted 1106
9 SASI_Hs01_00213957 predicted 1053
10 SASI_Hs02_00336797 predicted 199
11 SASI_Hs01_00213952 predicted 207
12 SASI_Hs01_00213953 predicted 1057
13 SASI_Hs01_00213955 predicted 214
14 SASI_Hs01_00213956 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120956 predicted 783
2 SASI_Rn01_00120957 predicted 540
3 SASI_Rn01_00120960 predicted 329
4 SASI_Rn02_00268648 predicted 1182
5 SASI_Rn01_00120961 predicted 1300
6 SASI_Rn01_00120964 predicted 918
7 SASI_Rn02_00268649 predicted 195
8 SASI_Rn02_00268650 predicted 536
9 SASI_Rn02_00268651 predicted 1064
10 SASI_Rn02_00268652 predicted 327
11 SASI_Rn01_00120955 predicted 1373
12 SASI_Rn01_00120958 predicted 211
13 SASI_Rn01_00120959 predicted 787
14 SASI_Rn01_00120962 predicted 1445
15 SASI_Rn01_00120963 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004043
ASMT MISSION shRNA Bacterial Glycerol Stock
acetylserotonin O-methyltransferase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004043.2-676s21c1
Sequence:CCGGGTCAGTGTTCCCACTTATGTGCTCGAGCACATAAGTGGGAACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-869s1c1
Sequence:CCGGCCTGGATGTAAGATCACCGTTCTCGAGAACGGTGATCTTACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-1153s1c1
Sequence:CCGGGCAGCTCTACTCTCTGAACATCTCGAGATGTTCAGAGAGTAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-263s1c1
Sequence:CCGGGCCTGCGAGCTGGGCGTGTTTCTCGAGAAACACGCCCAGCTCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-971s1c1
Sequence:CCGGGATTTCTTCAAAGACCCTCTTCTCGAGAAGAGGGTCTTTGAAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-211s1c1
Sequence:CCGGCCTCCTTAATGACTACGCCAACTCGAGTTGGCGTAGTCATTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004043
ASMT MISSION shRNA shRNA Plasmid DNA
acetylserotonin O-methyltransferase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004043.2-676s21c1
Sequence:CCGGGTCAGTGTTCCCACTTATGTGCTCGAGCACATAAGTGGGAACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-869s1c1
Sequence:CCGGCCTGGATGTAAGATCACCGTTCTCGAGAACGGTGATCTTACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-1153s1c1
Sequence:CCGGGCAGCTCTACTCTCTGAACATCTCGAGATGTTCAGAGAGTAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-263s1c1
Sequence:CCGGGCCTGCGAGCTGGGCGTGTTTCTCGAGAAACACGCCCAGCTCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-971s1c1
Sequence:CCGGGATTTCTTCAAAGACCCTCTTCTCGAGAAGAGGGTCTTTGAAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-211s1c1
Sequence:CCGGCCTCCTTAATGACTACGCCAACTCGAGTTGGCGTAGTCATTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004043
ASMT MISSION shRNA Lentiviral Transduction Particles
acetylserotonin O-methyltransferase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004043.2-676s21c1
Sequence:CCGGGTCAGTGTTCCCACTTATGTGCTCGAGCACATAAGTGGGAACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-869s1c1
Sequence:CCGGCCTGGATGTAAGATCACCGTTCTCGAGAACGGTGATCTTACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-1153s1c1
Sequence:CCGGGCAGCTCTACTCTCTGAACATCTCGAGATGTTCAGAGAGTAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-263s1c1
Sequence:CCGGGCCTGCGAGCTGGGCGTGTTTCTCGAGAAACACGCCCAGCTCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-971s1c1
Sequence:CCGGGATTTCTTCAAAGACCCTCTTCTCGAGAAGAGGGTCTTTGAAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004043.1-211s1c1
Sequence:CCGGCCTCCTTAATGACTACGCCAACTCGAGTTGGCGTAGTCATTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks