EMAIL THIS PAGE TO A FRIEND

ASMTL-AS1

ASMTL antisense RNA 1

30 Gene Product Result for
Synonyms: ASMTL-AS ASMTLAS CXYorf2 NCRNA00105
Species: Human ASMTL-AS1(80161)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025091 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025091 Rosetta Predictions human pricing
XR_040863 Rosetta Predictions human pricing
XR_040864 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141448 predicted 419
2 SASI_Hs01_00141449 predicted 411
3 SASI_Hs01_00141450 predicted 444
4 SASI_Hs01_00141451 predicted 449
5 SASI_Hs01_00141452 predicted 440
6 SASI_Hs01_00141453 predicted 454
7 SASI_Hs01_00141454 predicted 304
8 SASI_Hs01_00141455 predicted 234
9 SASI_Hs01_00141456 predicted 448
10 SASI_Hs01_00141457 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522617 predicted 965
2 SASI_Hs02_00522618 predicted 689
3 SASI_Hs02_00522619 predicted 681
4 SASI_Hs02_00522620 predicted 850
5 SASI_Hs02_00522621 predicted 536
6 SASI_Hs02_00522622 predicted 625
7 SASI_Hs02_00522623 predicted 507
8 SASI_Hs02_00522624 predicted 637
9 SASI_Hs02_00522625 predicted 622
10 SASI_Hs02_00522626 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522627 predicted 1484
2 SASI_Hs02_00522628 predicted 695
3 SASI_Hs02_00522629 predicted 1402
4 SASI_Hs02_00522630 predicted 544
5 SASI_Hs02_00522631 predicted 628
6 SASI_Hs02_00522632 predicted 619
7 SASI_Hs02_00522633 predicted 643
8 SASI_Hs02_00522634 predicted 383
9 SASI_Hs02_00522635 predicted 624
10 SASI_Hs02_00522636 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025091
ASMTL-AS1 MISSION shRNA Bacterial Glycerol Stock
ASMTL antisense RNA 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000180731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025091.2-541s1c1
Sequence:CCGGGAATGGGTCTTCCTGAAGTACCTCGAGGTACTTCAGGAAGACCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025091.2-765s1c1
Sequence:CCGGCACCTGGAAGTTCTCCTTCAACTCGAGTTGAAGGAGAACTTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025091
ASMTL-AS1 MISSION shRNA shRNA Plasmid DNA
ASMTL antisense RNA 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000180731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025091.2-541s1c1
Sequence:CCGGGAATGGGTCTTCCTGAAGTACCTCGAGGTACTTCAGGAAGACCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025091.2-765s1c1
Sequence:CCGGCACCTGGAAGTTCTCCTTCAACTCGAGTTGAAGGAGAACTTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025091
ASMTL-AS1 MISSION shRNA Lentiviral Transduction Particles
ASMTL antisense RNA 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000180731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025091.2-541s1c1
Sequence:CCGGGAATGGGTCTTCCTGAAGTACCTCGAGGTACTTCAGGAAGACCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025091.2-765s1c1
Sequence:CCGGCACCTGGAAGTTCTCCTTCAACTCGAGTTGAAGGAGAACTTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks