EMAIL THIS PAGE TO A FRIEND

ASMTL

acetylserotonin O-methyltransferase-like

Synonyms: ASMTLX ASMTLY ASTML
Gene ID:
Human(8623) Summary: The protein encoded by this gene has an N-terminus that is similar to the multicopy associated filamentation (maf) protein of Bacillus subtilis and to orfE of Escherichia coli, while the C-terminus is similar to N-acetylserotonin O-methyltransferase. This gene is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Rat(288527) acetylserotonin O-methyltransferase-like
naked mole-rat(101704436) acetylserotonin O-methyltransferase-like
Zebrafish(324134) acetylserotonin O-methyltransferase-like
cow(508458) acetylserotonin O-methyltransferase-like
domestic cat(101101111) acetylserotonin O-methyltransferase-like
dog(609318) acetylserotonin O-methyltransferase-like
chicken(769097) acetylserotonin O-methyltransferase-like
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004192 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084501 MISSION® esiRNA esiRNA human ASMTL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004192 Rosetta Predictions human pricing
XM_001713702 Rosetta Predictions human pricing
NM_001105915 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337080 predicted 1823
2 SASI_Hs02_00337081 predicted 1252
3 SASI_Hs02_00337082 predicted 1251
4 SASI_Hs02_00337083 predicted 1442
5 SASI_Hs01_00038372 predicted 1529
6 SASI_Hs01_00038376 predicted 1068
7 SASI_Hs01_00038371 predicted 1019
8 SASI_Hs01_00038377 predicted 464
9 SASI_Hs02_00337084 predicted 1168
10 SASI_Hs02_00337085 predicted 248
11 SASI_Hs01_00038368 predicted 1509
12 SASI_Hs01_00038369 predicted 1288
13 SASI_Hs01_00038370 predicted 1145
14 SASI_Hs01_00038373 predicted 1087
15 SASI_Hs01_00038374 predicted 370
16 SASI_Hs01_00038375 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392728 predicted 942
2 SASI_Hs02_00392729 predicted 961
3 SASI_Hs02_00392730 predicted 431
4 SASI_Hs02_00392731 predicted 726
5 SASI_Hs02_00392732 predicted 488
6 SASI_Hs02_00392733 predicted 379
7 SASI_Hs02_00392734 predicted 941
8 SASI_Hs02_00392735 predicted 382
9 SASI_Hs02_00392736 predicted 204
10 SASI_Hs02_00392737 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213792 predicted 432
2 SASI_Rn02_00213793 predicted 391
3 SASI_Rn02_00213794 predicted 399
4 SASI_Rn02_00213795 predicted 389
5 SASI_Rn02_00213796 predicted 397
6 SASI_Rn02_00213797 predicted 427
7 SASI_Rn02_00213798 predicted 401
8 SASI_Rn02_00213799 predicted 411
9 SASI_Rn02_00213800 predicted 424
10 SASI_Rn02_00213801 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004192
VALIDATED
ASMTL MISSION shRNA Bacterial Glycerol Stock
acetylserotonin O-methyltransferase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004192.1-432s1c1
Sequence:CCGGCTACGAGGAAACGAAGGTGAACTCGAGTTCACCTTCGTTTCCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004192.1-1423s1c1
Sequence:CCGGCGTATGCAGGTGACTGTGTTTCTCGAGAAACACAGTCACCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004192.1-914s1c1
Sequence:CCGGGCAAACTGAAGGTGTTCGATTCTCGAGAATCGAACACCTTCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_004192.1-1158s1c1
Sequence:CCGGCCTCTTTACATACCTGGAGTTCTCGAGAACTCCAGGTATGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1448s21c1
Sequence:CCGGCCTTCAATCTGTCCCGCTTCTCTCGAGAGAAGCGGGACAGATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1348s21c1
Sequence:CCGGCTGTTCCAGGATGCGTACTACCTCGAGGTAGTACGCATCCTGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004192.2-1026s21c1
Sequence:CCGGCAAACTGAAGGTGTTCGATTTCTCGAGAAATCGAACACCTTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1205s21c1
Sequence:CCGGTGGCATCGGATGGCGAATACTCTCGAGAGTATTCGCCATCCGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1162s21c1
Sequence:CCGGACAGAGCAAGGTTACAGTAACCTCGAGGTTACTGTAACCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004192.2-1256s21c1
Sequence:CCGGACCTCACATGGAACCTCTTTACTCGAGTAAAGAGGTTCCATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004192
VALIDATED
ASMTL MISSION shRNA shRNA Plasmid DNA
acetylserotonin O-methyltransferase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004192.1-432s1c1
Sequence:CCGGCTACGAGGAAACGAAGGTGAACTCGAGTTCACCTTCGTTTCCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004192.1-1423s1c1
Sequence:CCGGCGTATGCAGGTGACTGTGTTTCTCGAGAAACACAGTCACCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004192.1-914s1c1
Sequence:CCGGGCAAACTGAAGGTGTTCGATTCTCGAGAATCGAACACCTTCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_004192.1-1158s1c1
Sequence:CCGGCCTCTTTACATACCTGGAGTTCTCGAGAACTCCAGGTATGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1448s21c1
Sequence:CCGGCCTTCAATCTGTCCCGCTTCTCTCGAGAGAAGCGGGACAGATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1348s21c1
Sequence:CCGGCTGTTCCAGGATGCGTACTACCTCGAGGTAGTACGCATCCTGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004192.2-1026s21c1
Sequence:CCGGCAAACTGAAGGTGTTCGATTTCTCGAGAAATCGAACACCTTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1205s21c1
Sequence:CCGGTGGCATCGGATGGCGAATACTCTCGAGAGTATTCGCCATCCGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1162s21c1
Sequence:CCGGACAGAGCAAGGTTACAGTAACCTCGAGGTTACTGTAACCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004192.2-1256s21c1
Sequence:CCGGACCTCACATGGAACCTCTTTACTCGAGTAAAGAGGTTCCATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004192
VALIDATED
ASMTL MISSION shRNA Lentiviral Transduction Particles
acetylserotonin O-methyltransferase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004192.1-432s1c1
Sequence:CCGGCTACGAGGAAACGAAGGTGAACTCGAGTTCACCTTCGTTTCCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004192.1-1423s1c1
Sequence:CCGGCGTATGCAGGTGACTGTGTTTCTCGAGAAACACAGTCACCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004192.1-914s1c1
Sequence:CCGGGCAAACTGAAGGTGTTCGATTCTCGAGAATCGAACACCTTCAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_004192.1-1158s1c1
Sequence:CCGGCCTCTTTACATACCTGGAGTTCTCGAGAACTCCAGGTATGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1448s21c1
Sequence:CCGGCCTTCAATCTGTCCCGCTTCTCTCGAGAGAAGCGGGACAGATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1348s21c1
Sequence:CCGGCTGTTCCAGGATGCGTACTACCTCGAGGTAGTACGCATCCTGGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004192.2-1026s21c1
Sequence:CCGGCAAACTGAAGGTGTTCGATTTCTCGAGAAATCGAACACCTTCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1205s21c1
Sequence:CCGGTGGCATCGGATGGCGAATACTCTCGAGAGTATTCGCCATCCGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004192.2-1162s21c1
Sequence:CCGGACAGAGCAAGGTTACAGTAACCTCGAGGTTACTGTAACCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004192.2-1256s21c1
Sequence:CCGGACCTCACATGGAACCTCTTTACTCGAGTAAAGAGGTTCCATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks