EMAIL THIS PAGE TO A FRIEND

ASNA1

arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)

82 Gene Product Result for
Synonyms: ARSA-I ARSA1 ASNA-I GET3 TRC40 hASNA-I
UniProtKB ID: O43681, A6NHP8, A8K740, Q53FC6, Q92849
Gene ID:
Human(439) Summary: This gene represents the human homolog of the bacterial arsA gene, encoding the arsenite-stimulated ATPase component of the arsenite transporter responsible for resistance to arsenicals. This protein is also a central component of a transmembrane domain (TMD) recognition complex (TRC) that is involved in the post-translational delivery of tail-anchored (TA) proteins from the cytosol to the endoplasmic reticulum (ER). It recognizes and selectively binds the TMD of TA proteins in the cytosol, and delivers them to the ER for insertion. [provided by RefSeq, Oct 2011]
Mouse(56495) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Rat(288919) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Zebrafish(325704) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Horse(100063417) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
cow(504586) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
domestic cat(101085103) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
dog(476699) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
naked mole-rat(101711689) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
domestic guinea pig(100716352) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
sheep(101106257) arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004317 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004317 Rosetta Predictions human pricing
XM_001066031 Rosetta Predictions rat pricing
XM_213848 Rosetta Predictions rat pricing
NM_019652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233482 predicted 239
2 SASI_Hs01_00233483 predicted 591
3 SASI_Hs01_00233484 predicted 418
4 SASI_Hs01_00233485 predicted 281
5 SASI_Hs01_00233487 predicted 602
6 SASI_Hs02_00337349 predicted 576
7 SASI_Hs02_00337350 predicted 279
8 SASI_Hs02_00337351 predicted 348
9 SASI_Hs02_00337352 predicted 198
10 SASI_Hs02_00337353 predicted 419
11 SASI_Hs01_00233481 predicted 827
12 SASI_Hs01_00233486 predicted 582
13 SASI_Hs01_00233488 predicted 822
14 SASI_Hs01_00233489 predicted 895
15 SASI_Hs01_00233490 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316138 predicted 283
2 SASI_Rn02_00316139 predicted 202
3 SASI_Rn02_00316140 predicted 935
4 SASI_Rn02_00316141 predicted 823
5 SASI_Rn02_00316142 predicted 526
6 SASI_Rn02_00316143 predicted 995
7 SASI_Rn02_00316144 predicted 694
8 SASI_Rn02_00316145 predicted 531
9 SASI_Rn02_00316146 predicted 895
10 SASI_Rn02_00316147 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374976 predicted 895
2 SASI_Rn02_00374977 predicted 231
3 SASI_Rn02_00374978 predicted 298
4 SASI_Rn02_00374979 predicted 203
5 SASI_Rn02_00374980 predicted 1106
6 SASI_Rn02_00374981 predicted 272
7 SASI_Rn02_00374982 predicted 939
8 SASI_Rn02_00374983 predicted 968
9 SASI_Rn02_00374984 predicted 230
10 SASI_Rn02_00374985 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035238 predicted 866
2 SASI_Mm01_00035239 predicted 204
3 SASI_Mm01_00035240 predicted 232
4 SASI_Mm01_00035241 predicted 915
5 SASI_Mm01_00035242 predicted 675
6 SASI_Mm01_00035243 predicted 274
7 SASI_Mm01_00035244 predicted 387
8 SASI_Mm02_00324692 predicted 791
9 SASI_Mm01_00035245 predicted 227
10 SASI_Mm01_00035246 predicted 195
11 SASI_Mm01_00035247 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019652
VALIDATED
ASNA1 MISSION shRNA Bacterial Glycerol Stock
arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019652.1-1080s1c1
Sequence:CCGGTGCCTTCATACCCTCCTCTTTCTCGAGAAAGAGGAGGGTATGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019652.1-236s1c1
Sequence:CCGGCCAGCTCACAACATCTCAGATCTCGAGATCTGAGATGTTGTGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019652.1-116s1c1
Sequence:CCGGCGTAGCCTTAAGTGGATCTTTCTCGAGAAAGATCCACTTAAGGCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019652.1-700s1c1
Sequence:CCGGCCGATCTGTTAGCGAACAGTTCTCGAGAACTGTTCGCTAACAGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019652.1-932s1c1
Sequence:CCGGGAAGACCTATATGAAGACTTTCTCGAGAAAGTCTTCATATAGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-236s21c1
Sequence:CCGGCCAGCTCACAACATCTCAGATCTCGAGATCTGAGATGTTGTGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-116s21c1
Sequence:CCGGCGTAGCCTTAAGTGGATCTTTCTCGAGAAAGATCCACTTAAGGCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019652.1-1080s21c1
Sequence:CCGGTGCCTTCATACCCTCCTCTTTCTCGAGAAAGAGGAGGGTATGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-932s21c1
Sequence:CCGGGAAGACCTATATGAAGACTTTCTCGAGAAAGTCTTCATATAGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019652
VALIDATED
ASNA1 MISSION shRNA shRNA Plasmid DNA
arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019652.1-1080s1c1
Sequence:CCGGTGCCTTCATACCCTCCTCTTTCTCGAGAAAGAGGAGGGTATGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019652.1-236s1c1
Sequence:CCGGCCAGCTCACAACATCTCAGATCTCGAGATCTGAGATGTTGTGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019652.1-116s1c1
Sequence:CCGGCGTAGCCTTAAGTGGATCTTTCTCGAGAAAGATCCACTTAAGGCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019652.1-700s1c1
Sequence:CCGGCCGATCTGTTAGCGAACAGTTCTCGAGAACTGTTCGCTAACAGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019652.1-932s1c1
Sequence:CCGGGAAGACCTATATGAAGACTTTCTCGAGAAAGTCTTCATATAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-236s21c1
Sequence:CCGGCCAGCTCACAACATCTCAGATCTCGAGATCTGAGATGTTGTGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-116s21c1
Sequence:CCGGCGTAGCCTTAAGTGGATCTTTCTCGAGAAAGATCCACTTAAGGCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019652.1-1080s21c1
Sequence:CCGGTGCCTTCATACCCTCCTCTTTCTCGAGAAAGAGGAGGGTATGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-932s21c1
Sequence:CCGGGAAGACCTATATGAAGACTTTCTCGAGAAAGTCTTCATATAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019652
VALIDATED
ASNA1 MISSION shRNA Lentiviral Transduction Particles
arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019652.1-1080s1c1
Sequence:CCGGTGCCTTCATACCCTCCTCTTTCTCGAGAAAGAGGAGGGTATGAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019652.1-236s1c1
Sequence:CCGGCCAGCTCACAACATCTCAGATCTCGAGATCTGAGATGTTGTGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019652.1-116s1c1
Sequence:CCGGCGTAGCCTTAAGTGGATCTTTCTCGAGAAAGATCCACTTAAGGCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019652.1-700s1c1
Sequence:CCGGCCGATCTGTTAGCGAACAGTTCTCGAGAACTGTTCGCTAACAGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019652.1-932s1c1
Sequence:CCGGGAAGACCTATATGAAGACTTTCTCGAGAAAGTCTTCATATAGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-236s21c1
Sequence:CCGGCCAGCTCACAACATCTCAGATCTCGAGATCTGAGATGTTGTGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-116s21c1
Sequence:CCGGCGTAGCCTTAAGTGGATCTTTCTCGAGAAAGATCCACTTAAGGCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019652.1-1080s21c1
Sequence:CCGGTGCCTTCATACCCTCCTCTTTCTCGAGAAAGAGGAGGGTATGAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019652.1-932s21c1
Sequence:CCGGGAAGACCTATATGAAGACTTTCTCGAGAAAGTCTTCATATAGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004317
VALIDATED
ASNA1 MISSION shRNA Bacterial Glycerol Stock
arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004317.1-223s1c1
Sequence:CCGGCCTACCAAGGTCAAAGGCTATCTCGAGATAGCCTTTGACCTTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-838s1c1
Sequence:CCGGCACAAGATCCAGGCCAAGTATCTCGAGATACTTGGCCTGGATCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-516s1c1
Sequence:CCGGCCGGCTTATGCAGATCAAGAACTCGAGTTCTTGATCTGCATAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-755s1c1
Sequence:CCGGGCAAGATTGACACACACAATACTCGAGTATTGTGTGTGTCAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-666s1c1
Sequence:CCGGCCCTGAGCAGACAACTTTCATCTCGAGATGAAAGTTGTCTGCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-490s21c1
Sequence:GTACCGGACTTCTCGGTGGTGGTATTTGCTCGAGCAAATACCACCACCGAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-817s21c1
Sequence:CCGGGCAAGATTGACACACACAATACTCGAGTATTGTGTGTGTCAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004317.2-578s21c1
Sequence:CCGGCCGGCTTATGCAGATCAAGAACTCGAGTTCTTGATCTGCATAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-900s21c1
Sequence:CCGGCACAAGATCCAGGCCAAGTATCTCGAGATACTTGGCCTGGATCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-728s21c1
Sequence:CCGGCCCTGAGCAGACAACTTTCATCTCGAGATGAAAGTTGTCTGCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004317
VALIDATED
ASNA1 MISSION shRNA shRNA Plasmid DNA
arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004317.1-223s1c1
Sequence:CCGGCCTACCAAGGTCAAAGGCTATCTCGAGATAGCCTTTGACCTTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-838s1c1
Sequence:CCGGCACAAGATCCAGGCCAAGTATCTCGAGATACTTGGCCTGGATCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-516s1c1
Sequence:CCGGCCGGCTTATGCAGATCAAGAACTCGAGTTCTTGATCTGCATAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-755s1c1
Sequence:CCGGGCAAGATTGACACACACAATACTCGAGTATTGTGTGTGTCAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-666s1c1
Sequence:CCGGCCCTGAGCAGACAACTTTCATCTCGAGATGAAAGTTGTCTGCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-490s21c1
Sequence:GTACCGGACTTCTCGGTGGTGGTATTTGCTCGAGCAAATACCACCACCGAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-817s21c1
Sequence:CCGGGCAAGATTGACACACACAATACTCGAGTATTGTGTGTGTCAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004317.2-578s21c1
Sequence:CCGGCCGGCTTATGCAGATCAAGAACTCGAGTTCTTGATCTGCATAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-900s21c1
Sequence:CCGGCACAAGATCCAGGCCAAGTATCTCGAGATACTTGGCCTGGATCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-728s21c1
Sequence:CCGGCCCTGAGCAGACAACTTTCATCTCGAGATGAAAGTTGTCTGCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004317
VALIDATED
ASNA1 MISSION shRNA Lentiviral Transduction Particles
arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004317.1-223s1c1
Sequence:CCGGCCTACCAAGGTCAAAGGCTATCTCGAGATAGCCTTTGACCTTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-838s1c1
Sequence:CCGGCACAAGATCCAGGCCAAGTATCTCGAGATACTTGGCCTGGATCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-516s1c1
Sequence:CCGGCCGGCTTATGCAGATCAAGAACTCGAGTTCTTGATCTGCATAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-755s1c1
Sequence:CCGGGCAAGATTGACACACACAATACTCGAGTATTGTGTGTGTCAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004317.1-666s1c1
Sequence:CCGGCCCTGAGCAGACAACTTTCATCTCGAGATGAAAGTTGTCTGCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-490s21c1
Sequence:GTACCGGACTTCTCGGTGGTGGTATTTGCTCGAGCAAATACCACCACCGAGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-817s21c1
Sequence:CCGGGCAAGATTGACACACACAATACTCGAGTATTGTGTGTGTCAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004317.2-578s21c1
Sequence:CCGGCCGGCTTATGCAGATCAAGAACTCGAGTTCTTGATCTGCATAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-900s21c1
Sequence:CCGGCACAAGATCCAGGCCAAGTATCTCGAGATACTTGGCCTGGATCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004317.2-728s21c1
Sequence:CCGGCCCTGAGCAGACAACTTTCATCTCGAGATGAAAGTTGTCTGCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)