EMAIL THIS PAGE TO A FRIEND

ASNS

asparagine synthetase (glutamine-hydrolyzing)

79 Gene Product Result for
Synonyms: TS11
Gene ID:
Human(440) Summary: The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
Mouse(27053) asparagine synthetase
Rat(25612) asparagine synthetase (glutamine-hydrolyzing)
sheep(101120073) asparagine synthetase (glutamine-hydrolyzing)
naked mole-rat(101704060) asparagine synthetase (glutamine-hydrolyzing)
Zebrafish(394138) asparagine synthetase
dog(475240) asparagine synthetase (glutamine-hydrolyzing)
chicken(420574) asparagine synthetase (glutamine-hydrolyzing)
cow(514209) asparagine synthetase (glutamine-hydrolyzing)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001673 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001673 Rosetta Predictions human pricing
NM_133436 Rosetta Predictions human pricing
NM_183356 Rosetta Predictions human pricing
NM_013079 Rosetta Predictions rat pricing
NM_012055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332309 predicted 665
2 SASI_Hs01_00116721 predicted 1598
3 SASI_Hs01_00116722 predicted 1204
4 SASI_Hs01_00116723 predicted 978
5 SASI_Hs01_00116724 predicted 1788
6 SASI_Hs01_00116725 predicted 727
7 SASI_Hs01_00116726 predicted 1743
8 SASI_Hs01_00116728 predicted 1802
9 SASI_Hs01_00116729 predicted 618
10 SASI_Hs01_00116730 predicted 1096
11 SASI_Hs01_00116727 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363109 predicted 918
2 SASI_Hs01_00234578 predicted 1848
3 SASI_Hs01_00234579 predicted 1460
4 SASI_Hs01_00234580 predicted 1234
5 SASI_Hs01_00234581 predicted 2042
6 SASI_Hs01_00234582 predicted 982
7 SASI_Hs01_00234583 predicted 2000
8 SASI_Hs01_00234585 predicted 2052
9 SASI_Hs01_00234586 predicted 876
10 SASI_Hs01_00234587 predicted 1352
11 SASI_Hs01_00234584 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371270 predicted 942
2 SASI_Hs01_00048120 predicted 1871
3 SASI_Hs01_00048121 predicted 1485
4 SASI_Hs01_00048122 predicted 1260
5 SASI_Hs01_00048123 predicted 2064
6 SASI_Hs01_00048124 predicted 1004
7 SASI_Hs01_00048125 predicted 2016
8 SASI_Hs01_00048127 predicted 2077
9 SASI_Hs01_00048128 predicted 895
10 SASI_Hs01_00048129 predicted 1369
11 SASI_Hs01_00048126 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062685 predicted 470
2 SASI_Rn01_00062686 predicted 434
3 SASI_Rn01_00062687 predicted 424
4 SASI_Rn01_00062688 predicted 388
5 SASI_Rn01_00062689 predicted 1718
6 SASI_Rn01_00062690 predicted 1603
7 SASI_Rn01_00062691 predicted 834
8 SASI_Rn02_00260842 predicted 1135
9 SASI_Rn01_00062692 predicted 1552
10 SASI_Rn01_00062694 predicted 1729
11 SASI_Rn01_00062693 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322031 predicted 274
2 SASI_Mm01_00078034 predicted 1390
3 SASI_Mm01_00078035 predicted 727
4 SASI_Mm02_00322032 predicted 756
5 SASI_Mm01_00078036 predicted 1682
6 SASI_Mm01_00078038 predicted 411
7 SASI_Mm01_00078039 predicted 1004
8 SASI_Mm01_00078040 predicted 1636
9 SASI_Mm01_00078042 predicted 261
10 SASI_Mm01_00078043 predicted 359
11 SASI_Mm01_00078037 predicted 578
12 SASI_Mm01_00078041 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012055
ASNS MISSION shRNA Bacterial Glycerol Stock
asparagine synthetase (glutamine-hydrolyzing)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-820s21c1
Sequence:CCGGCGCTATCAAGAAACGCTTGATCTCGAGATCAAGCGTTTCTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-1602s21c1
Sequence:CCGGCCCAGAAGTTTCCCTTCAATACTCGAGTATTGAAGGGAAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-1396s21c1
Sequence:CCGGGCCAGATATGAGAATTCCAAACTCGAGTTTGGAATTCTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-298s21c1
Sequence:CCGGCCCTTATTTGTGGCTCTGTTACTCGAGTAACAGAGCCACAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-787s21c1
Sequence:CCGGCGTGAAGAACAATCTGCGTATCTCGAGATACGCAGATTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-299s1c1
Sequence:CCGGCCCTTATTTGTGGCTCTGTTACTCGAGTAACAGAGCCACAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-788s1c1
Sequence:CCGGCGTGAAGAACAATCTGCGTATCTCGAGATACGCAGATTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-1397s1c1
Sequence:CCGGGCCAGATATGAGAATTCCAAACTCGAGTTTGGAATTCTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-821s1c1
Sequence:CCGGCGCTATCAAGAAACGCTTGATCTCGAGATCAAGCGTTTCTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-1603s1c1
Sequence:CCGGCCCAGAAGTTTCCCTTCAATACTCGAGTATTGAAGGGAAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012055
ASNS MISSION shRNA shRNA Plasmid DNA
asparagine synthetase (glutamine-hydrolyzing)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-820s21c1
Sequence:CCGGCGCTATCAAGAAACGCTTGATCTCGAGATCAAGCGTTTCTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-1602s21c1
Sequence:CCGGCCCAGAAGTTTCCCTTCAATACTCGAGTATTGAAGGGAAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-1396s21c1
Sequence:CCGGGCCAGATATGAGAATTCCAAACTCGAGTTTGGAATTCTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-298s21c1
Sequence:CCGGCCCTTATTTGTGGCTCTGTTACTCGAGTAACAGAGCCACAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-787s21c1
Sequence:CCGGCGTGAAGAACAATCTGCGTATCTCGAGATACGCAGATTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-299s1c1
Sequence:CCGGCCCTTATTTGTGGCTCTGTTACTCGAGTAACAGAGCCACAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-788s1c1
Sequence:CCGGCGTGAAGAACAATCTGCGTATCTCGAGATACGCAGATTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-1397s1c1
Sequence:CCGGGCCAGATATGAGAATTCCAAACTCGAGTTTGGAATTCTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-821s1c1
Sequence:CCGGCGCTATCAAGAAACGCTTGATCTCGAGATCAAGCGTTTCTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-1603s1c1
Sequence:CCGGCCCAGAAGTTTCCCTTCAATACTCGAGTATTGAAGGGAAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012055
ASNS MISSION shRNA Lentiviral Transduction Particles
asparagine synthetase (glutamine-hydrolyzing)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-820s21c1
Sequence:CCGGCGCTATCAAGAAACGCTTGATCTCGAGATCAAGCGTTTCTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-1602s21c1
Sequence:CCGGCCCAGAAGTTTCCCTTCAATACTCGAGTATTGAAGGGAAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-1396s21c1
Sequence:CCGGGCCAGATATGAGAATTCCAAACTCGAGTTTGGAATTCTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-298s21c1
Sequence:CCGGCCCTTATTTGTGGCTCTGTTACTCGAGTAACAGAGCCACAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012055.3-787s21c1
Sequence:CCGGCGTGAAGAACAATCTGCGTATCTCGAGATACGCAGATTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-299s1c1
Sequence:CCGGCCCTTATTTGTGGCTCTGTTACTCGAGTAACAGAGCCACAAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-788s1c1
Sequence:CCGGCGTGAAGAACAATCTGCGTATCTCGAGATACGCAGATTGTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-1397s1c1
Sequence:CCGGGCCAGATATGAGAATTCCAAACTCGAGTTTGGAATTCTCATATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-821s1c1
Sequence:CCGGCGCTATCAAGAAACGCTTGATCTCGAGATCAAGCGTTTCTTGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012055.1-1603s1c1
Sequence:CCGGCCCAGAAGTTTCCCTTCAATACTCGAGTATTGAAGGGAAACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001673
VALIDATED
ASNS MISSION shRNA Bacterial Glycerol Stock
asparagine synthetase (glutamine-hydrolyzing)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-1806s21c1
Sequence:CCGGCGTCAAGTCTTTGAACGCCATCTCGAGATGGCGTTCAAAGACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-1174s21c1
Sequence:CCGGGTGAACATTATGAAGTCCTTTCTCGAGAAAGGACTTCATAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-438s21c1
Sequence:CCGGCGAGTGAAGAAATATCCGTATCTCGAGATACGGATATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-717s21c1
Sequence:CCGGGCTGTATGTTCAGAAGCTAAACTCGAGTTTAGCTTCTGAACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-393s1c1
Sequence:CCGGGCTCTGTTACAATGGTGAAATCTCGAGATTTCACCATTGTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-1735s1c1
Sequence:CCGGCGTCAAGTCTTTGAACGCCATCTCGAGATGGCGTTCAAAGACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-646s1c1
Sequence:CCGGGCTGTATGTTCAGAAGCTAAACTCGAGTTTAGCTTCTGAACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-1103s1c1
Sequence:CCGGGTGAACATTATGAAGTCCTTTCTCGAGAAAGGACTTCATAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-367s1c1
Sequence:CCGGCGAGTGAAGAAATATCCGTATCTCGAGATACGGATATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001673
VALIDATED
ASNS MISSION shRNA shRNA Plasmid DNA
asparagine synthetase (glutamine-hydrolyzing)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-1806s21c1
Sequence:CCGGCGTCAAGTCTTTGAACGCCATCTCGAGATGGCGTTCAAAGACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-1174s21c1
Sequence:CCGGGTGAACATTATGAAGTCCTTTCTCGAGAAAGGACTTCATAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-438s21c1
Sequence:CCGGCGAGTGAAGAAATATCCGTATCTCGAGATACGGATATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-717s21c1
Sequence:CCGGGCTGTATGTTCAGAAGCTAAACTCGAGTTTAGCTTCTGAACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-393s1c1
Sequence:CCGGGCTCTGTTACAATGGTGAAATCTCGAGATTTCACCATTGTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-1735s1c1
Sequence:CCGGCGTCAAGTCTTTGAACGCCATCTCGAGATGGCGTTCAAAGACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-646s1c1
Sequence:CCGGGCTGTATGTTCAGAAGCTAAACTCGAGTTTAGCTTCTGAACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-1103s1c1
Sequence:CCGGGTGAACATTATGAAGTCCTTTCTCGAGAAAGGACTTCATAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-367s1c1
Sequence:CCGGCGAGTGAAGAAATATCCGTATCTCGAGATACGGATATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001673
VALIDATED
ASNS MISSION shRNA Lentiviral Transduction Particles
asparagine synthetase (glutamine-hydrolyzing)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-1806s21c1
Sequence:CCGGCGTCAAGTCTTTGAACGCCATCTCGAGATGGCGTTCAAAGACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-1174s21c1
Sequence:CCGGGTGAACATTATGAAGTCCTTTCTCGAGAAAGGACTTCATAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-438s21c1
Sequence:CCGGCGAGTGAAGAAATATCCGTATCTCGAGATACGGATATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001673.3-717s21c1
Sequence:CCGGGCTGTATGTTCAGAAGCTAAACTCGAGTTTAGCTTCTGAACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-393s1c1
Sequence:CCGGGCTCTGTTACAATGGTGAAATCTCGAGATTTCACCATTGTAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-1735s1c1
Sequence:CCGGCGTCAAGTCTTTGAACGCCATCTCGAGATGGCGTTCAAAGACTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-646s1c1
Sequence:CCGGGCTGTATGTTCAGAAGCTAAACTCGAGTTTAGCTTCTGAACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-1103s1c1
Sequence:CCGGGTGAACATTATGAAGTCCTTTCTCGAGAAAGGACTTCATAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001673.2-367s1c1
Sequence:CCGGCGAGTGAAGAAATATCCGTATCTCGAGATACGGATATTTCTTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks