EMAIL THIS PAGE TO A FRIEND

ASNSD1

asparagine synthetase domain containing 1

50 Gene Product Result for
Synonyms: NBLA00058 NS3TP1
UniProtKB ID: Q9NWL6, D3DPH6, Q3LIC3, Q4ZG45
Gene ID:
Mouse(70396) asparagine synthetase domain containing 1
Rat(299507) asparagine synthetase domain containing 1
Zebrafish(368827) asparagine synthetase domain containing 1
cow(539672) asparagine synthetase domain containing 1
Horse(100069270) asparagine synthetase domain containing 1
domestic cat(101101577) asparagine synthetase domain containing 1
dog(478838) asparagine synthetase domain containing 1
chicken(423983) asparagine synthetase domain containing 1
domestic guinea pig(100719650) asparagine synthetase domain containing 1
sheep(101113564) asparagine synthetase domain containing 1
Domestic Rabbit(100356555) asparagine synthetase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019048 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019048 Rosetta Predictions human pricing
NM_001106763 Rosetta Predictions rat pricing
NM_133728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011236 predicted 1171
2 SASI_Hs01_00011237 predicted 612
3 SASI_Hs02_00352617 predicted 1304
4 SASI_Hs01_00011239 predicted 1043
5 SASI_Hs01_00011240 predicted 850
6 SASI_Hs01_00011241 predicted 1986
7 SASI_Hs01_00011242 predicted 1852
8 SASI_Hs01_00011243 predicted 889
9 SASI_Hs02_00352618 predicted 947
10 SASI_Hs01_00011244 predicted 1288
11 SASI_Hs01_00011238 predicted 1724
12 SASI_Hs01_00011245 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222158 predicted 1709
2 SASI_Rn02_00222159 predicted 575
3 SASI_Rn02_00222160 predicted 1065
4 SASI_Rn02_00222161 predicted 370
5 SASI_Rn02_00222162 predicted 1496
6 SASI_Rn02_00222163 predicted 426
7 SASI_Rn02_00222164 predicted 460
8 SASI_Rn02_00222165 predicted 897
9 SASI_Rn02_00222166 predicted 1324
10 SASI_Rn02_00222167 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058910 predicted 596
2 SASI_Mm01_00058911 predicted 453
3 SASI_Mm01_00058912 predicted 431
4 SASI_Mm01_00058913 predicted 513
5 SASI_Mm01_00058914 predicted 1692
6 SASI_Mm01_00058916 predicted 1805
7 SASI_Mm01_00058917 predicted 1001
8 SASI_Mm02_00338708 predicted 692
9 SASI_Mm01_00058918 predicted 1984
10 SASI_Mm01_00058919 predicted 831
11 SASI_Mm01_00058915 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133728
VALIDATED
ASNSD1 MISSION shRNA Bacterial Glycerol Stock
asparagine synthetase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-694s1c1
Sequence:CCGGCCTGTAAGAATGAGTCTGAAACTCGAGTTTCAGACTCATTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1640s1c1
Sequence:CCGGCCCTTCTCGAACTTGGAATTTCTCGAGAAATTCCAAGTTCGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133728.2-827s1c1
Sequence:CCGGGCAGTTTAGTAATCTGGGCAACTCGAGTTGCCCAGATTACTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1707s1c1
Sequence:CCGGGCTCGAATATGTCACTTAGTTCTCGAGAACTAAGTGACATATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1059s1c1
Sequence:CCGGCCAGAGTTTGTATCAGTGGTACTCGAGTACCACTGATACAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-979s21c1
Sequence:CCGGTATATCCTTGGAGATACATTTCTCGAGAAATGTATCTCCAAGGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-1640s21c1
Sequence:CCGGCCCTTCTCGAACTTGGAATTTCTCGAGAAATTCCAAGTTCGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-694s21c1
Sequence:CCGGCCTGTAAGAATGAGTCTGAAACTCGAGTTTCAGACTCATTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-1707s21c1
Sequence:CCGGGCTCGAATATGTCACTTAGTTCTCGAGAACTAAGTGACATATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133728
VALIDATED
ASNSD1 MISSION shRNA shRNA Plasmid DNA
asparagine synthetase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-694s1c1
Sequence:CCGGCCTGTAAGAATGAGTCTGAAACTCGAGTTTCAGACTCATTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1640s1c1
Sequence:CCGGCCCTTCTCGAACTTGGAATTTCTCGAGAAATTCCAAGTTCGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133728.2-827s1c1
Sequence:CCGGGCAGTTTAGTAATCTGGGCAACTCGAGTTGCCCAGATTACTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1707s1c1
Sequence:CCGGGCTCGAATATGTCACTTAGTTCTCGAGAACTAAGTGACATATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1059s1c1
Sequence:CCGGCCAGAGTTTGTATCAGTGGTACTCGAGTACCACTGATACAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-979s21c1
Sequence:CCGGTATATCCTTGGAGATACATTTCTCGAGAAATGTATCTCCAAGGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-1640s21c1
Sequence:CCGGCCCTTCTCGAACTTGGAATTTCTCGAGAAATTCCAAGTTCGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-694s21c1
Sequence:CCGGCCTGTAAGAATGAGTCTGAAACTCGAGTTTCAGACTCATTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-1707s21c1
Sequence:CCGGGCTCGAATATGTCACTTAGTTCTCGAGAACTAAGTGACATATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133728
VALIDATED
ASNSD1 MISSION shRNA Lentiviral Transduction Particles
asparagine synthetase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-694s1c1
Sequence:CCGGCCTGTAAGAATGAGTCTGAAACTCGAGTTTCAGACTCATTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1640s1c1
Sequence:CCGGCCCTTCTCGAACTTGGAATTTCTCGAGAAATTCCAAGTTCGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133728.2-827s1c1
Sequence:CCGGGCAGTTTAGTAATCTGGGCAACTCGAGTTGCCCAGATTACTAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1707s1c1
Sequence:CCGGGCTCGAATATGTCACTTAGTTCTCGAGAACTAAGTGACATATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133728.2-1059s1c1
Sequence:CCGGCCAGAGTTTGTATCAGTGGTACTCGAGTACCACTGATACAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-979s21c1
Sequence:CCGGTATATCCTTGGAGATACATTTCTCGAGAAATGTATCTCCAAGGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-1640s21c1
Sequence:CCGGCCCTTCTCGAACTTGGAATTTCTCGAGAAATTCCAAGTTCGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-694s21c1
Sequence:CCGGCCTGTAAGAATGAGTCTGAAACTCGAGTTTCAGACTCATTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133728.2-1707s21c1
Sequence:CCGGGCTCGAATATGTCACTTAGTTCTCGAGAACTAAGTGACATATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019048
VALIDATED
ASNSD1 MISSION shRNA Bacterial Glycerol Stock
asparagine synthetase domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019048.1-2289s1c1
Sequence:CCGGCGGCTCCAAATCATGTCCTTACTCGAGTAAGGACATGATTTGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019048.2-468s21c1
Sequence:CCGGGCTGAGCATTTCAGTCAAGATCTCGAGATCTTGACTGAAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-1688s21c1
Sequence:CCGGTGTTAGCCCTTCCCGAATTTGCTCGAGCAAATTCGGGAAGGGCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-2002s21c1
Sequence:CCGGTGATGGAACTGGGTCGAATTTCTCGAGAAATTCGACCCAGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-778s21c1
Sequence:CCGGTACAAGGTCCCTGGTCATTTACTCGAGTAAATGACCAGGGACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-1419s21c1
Sequence:CCGGGGCATTGATTCCATGGTTATTCTCGAGAATAACCATGGAATCAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019048
VALIDATED
ASNSD1 MISSION shRNA shRNA Plasmid DNA
asparagine synthetase domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019048.1-2289s1c1
Sequence:CCGGCGGCTCCAAATCATGTCCTTACTCGAGTAAGGACATGATTTGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019048.2-468s21c1
Sequence:CCGGGCTGAGCATTTCAGTCAAGATCTCGAGATCTTGACTGAAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-1688s21c1
Sequence:CCGGTGTTAGCCCTTCCCGAATTTGCTCGAGCAAATTCGGGAAGGGCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-2002s21c1
Sequence:CCGGTGATGGAACTGGGTCGAATTTCTCGAGAAATTCGACCCAGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-778s21c1
Sequence:CCGGTACAAGGTCCCTGGTCATTTACTCGAGTAAATGACCAGGGACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-1419s21c1
Sequence:CCGGGGCATTGATTCCATGGTTATTCTCGAGAATAACCATGGAATCAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019048
VALIDATED
ASNSD1 MISSION shRNA Lentiviral Transduction Particles
asparagine synthetase domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019048.1-2289s1c1
Sequence:CCGGCGGCTCCAAATCATGTCCTTACTCGAGTAAGGACATGATTTGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_019048.2-468s21c1
Sequence:CCGGGCTGAGCATTTCAGTCAAGATCTCGAGATCTTGACTGAAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-1688s21c1
Sequence:CCGGTGTTAGCCCTTCCCGAATTTGCTCGAGCAAATTCGGGAAGGGCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-2002s21c1
Sequence:CCGGTGATGGAACTGGGTCGAATTTCTCGAGAAATTCGACCCAGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-778s21c1
Sequence:CCGGTACAAGGTCCCTGGTCATTTACTCGAGTAAATGACCAGGGACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019048.2-1419s21c1
Sequence:CCGGGGCATTGATTCCATGGTTATTCTCGAGAATAACCATGGAATCAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks