EMAIL THIS PAGE TO A FRIEND

ASPA

aspartoacylase

90 Gene Product Result for
Synonyms: ACY2 ASP
UniProtKB ID: P45381
Gene ID:
Human(443) Summary: This gene encodes an enzyme that catalyzes the conversion of N-acetyl_L-aspartic acid (NAA) to aspartate and acetate. NAA is abundant in the brain where hydrolysis by aspartoacylase is thought to help maintain white matter. This protein is an NAA scavenger in other tissues. Mutations in this gene cause Canavan disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11484) aspartoacylase
Rat(79251) aspartoacylase
Zebrafish(557232) aspartoacylase
chicken(417609) aspartoacylase
dog(611064) aspartoacylase
domestic cat(101094220) aspartoacylase
cow(509432) aspartoacylase
Horse(100060454) aspartoacylase
naked mole-rat(101719646) aspartoacylase
sheep(101121435) aspartoacylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A6860 Anti-ASPA (246-260) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A6735 Anti-ASPA (76-90) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501363 Anti-Aspa (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
SAB1405493 Anti-ASPA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA022142 Anti-ASPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry, western blot pricing
HPA022145 Anti-ASPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104050 Anti-ASPA antibody produced in rabbit affinity isolated antibody zebrafish, mouse, pig, horse, rabbit, human, rat, canine, bovine, guinea pig
western blot pricing
SAB2104106 Anti-ASPA, (N-terminal) antibody produced in rabbit affinity isolated antibody pig, rat, rabbit, zebrafish, canine, guinea pig, bovine, mouse, human, horse
western blot pricing
WH0000443M9 Monoclonal Anti-ASPA antibody produced in mouse clone 3C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000049 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000049 Rosetta Predictions human pricing
NM_001128085 Rosetta Predictions human pricing
NM_024399 Rosetta Predictions rat pricing
NM_023113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032579 predicted 669
2 SASI_Hs01_00032580 predicted 401
3 SASI_Hs01_00032581 predicted 673
4 SASI_Hs01_00032582 predicted 215
5 SASI_Hs01_00032583 predicted 723
6 SASI_Hs02_00301744 predicted 722
7 SASI_Hs02_00301745 predicted 323
8 SASI_Hs01_00032585 predicted 873
9 SASI_Hs01_00032586 predicted 232
10 SASI_Hs02_00301746 predicted 670
11 SASI_Hs01_00032584 predicted 748
12 SASI_Hs01_00032587 predicted 572
13 SASI_Hs01_00032588 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330506 predicted 605
2 SASI_Hs02_00330507 predicted 286
3 SASI_Hs02_00330508 predicted 741
4 SASI_Hs02_00330509 predicted 262
5 SASI_Hs02_00330510 predicted 804
6 SASI_Hs02_00330511 predicted 454
7 SASI_Hs02_00330512 predicted 833
8 SASI_Hs02_00330513 predicted 521
9 SASI_Hs02_00330514 predicted 458
10 SASI_Hs02_00330515 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117125 predicted 680
2 SASI_Rn01_00117126 predicted 569
3 SASI_Rn01_00117127 predicted 642
4 SASI_Rn01_00117128 predicted 378
5 SASI_Rn01_00117129 predicted 780
6 SASI_Rn01_00117130 predicted 231
7 SASI_Rn02_00263998 predicted 1223
8 SASI_Rn01_00117131 predicted 537
9 SASI_Rn01_00117132 predicted 1300
10 SASI_Rn01_00117133 predicted 502
11 SASI_Rn01_00117134 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199688 predicted 648
2 SASI_Mm01_00199689 predicted 775
3 SASI_Mm01_00199690 predicted 690
4 SASI_Mm02_00326791 predicted 1215
5 SASI_Mm01_00199692 predicted 1299
6 SASI_Mm01_00199693 predicted 510
7 SASI_Mm01_00199694 predicted 282
8 SASI_Mm01_00199695 predicted 206
9 SASI_Mm01_00199696 predicted 379
10 SASI_Mm02_00326792 predicted 582
11 SASI_Mm01_00199687 predicted 422
12 SASI_Mm01_00199691 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023113
VALIDATED
ASPA MISSION shRNA Bacterial Glycerol Stock
aspartoacylase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-796s21c1
Sequence:CCGGTGTTCTATTGACGTCTATAAACTCGAGTTTATAGACGTCAATAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-595s21c1
Sequence:CCGGCCCTGCTCTGTTTATCTCATTCTCGAGAATGAGATAAACAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-486s21c1
Sequence:CCGGCCTTCACAACACCACTTCTAACTCGAGTTAGAAGTGGTGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-1295s21c1
Sequence:CCGGGCTTCTGGTTTCTGTATTATTCTCGAGAATAATACAGAAACCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-1296s1c1
Sequence:CCGGGCTTCTGGTTTCTGTATTATTCTCGAGAATAATACAGAAACCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023113.3-596s1c1
Sequence:CCGGCCCTGCTCTGTTTATCTCATTCTCGAGAATGAGATAAACAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-863s1c1
Sequence:CCGGGCTGCTGTTATTCATCCTAATCTCGAGATTAGGATGAATAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-644s1c1
Sequence:CCGGACTCGTTCCATTGCCAAGTATCTCGAGATACTTGGCAATGGAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023113.3-487s1c1
Sequence:CCGGCCTTCACAACACCACTTCTAACTCGAGTTAGAAGTGGTGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023113
VALIDATED
ASPA MISSION shRNA shRNA Plasmid DNA
aspartoacylase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-796s21c1
Sequence:CCGGTGTTCTATTGACGTCTATAAACTCGAGTTTATAGACGTCAATAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-595s21c1
Sequence:CCGGCCCTGCTCTGTTTATCTCATTCTCGAGAATGAGATAAACAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-486s21c1
Sequence:CCGGCCTTCACAACACCACTTCTAACTCGAGTTAGAAGTGGTGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-1295s21c1
Sequence:CCGGGCTTCTGGTTTCTGTATTATTCTCGAGAATAATACAGAAACCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-1296s1c1
Sequence:CCGGGCTTCTGGTTTCTGTATTATTCTCGAGAATAATACAGAAACCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023113.3-596s1c1
Sequence:CCGGCCCTGCTCTGTTTATCTCATTCTCGAGAATGAGATAAACAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-863s1c1
Sequence:CCGGGCTGCTGTTATTCATCCTAATCTCGAGATTAGGATGAATAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-644s1c1
Sequence:CCGGACTCGTTCCATTGCCAAGTATCTCGAGATACTTGGCAATGGAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023113.3-487s1c1
Sequence:CCGGCCTTCACAACACCACTTCTAACTCGAGTTAGAAGTGGTGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023113
VALIDATED
ASPA MISSION shRNA Lentiviral Transduction Particles
aspartoacylase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-796s21c1
Sequence:CCGGTGTTCTATTGACGTCTATAAACTCGAGTTTATAGACGTCAATAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-595s21c1
Sequence:CCGGCCCTGCTCTGTTTATCTCATTCTCGAGAATGAGATAAACAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-486s21c1
Sequence:CCGGCCTTCACAACACCACTTCTAACTCGAGTTAGAAGTGGTGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023113.4-1295s21c1
Sequence:CCGGGCTTCTGGTTTCTGTATTATTCTCGAGAATAATACAGAAACCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-1296s1c1
Sequence:CCGGGCTTCTGGTTTCTGTATTATTCTCGAGAATAATACAGAAACCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023113.3-596s1c1
Sequence:CCGGCCCTGCTCTGTTTATCTCATTCTCGAGAATGAGATAAACAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-863s1c1
Sequence:CCGGGCTGCTGTTATTCATCCTAATCTCGAGATTAGGATGAATAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023113.3-644s1c1
Sequence:CCGGACTCGTTCCATTGCCAAGTATCTCGAGATACTTGGCAATGGAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023113.3-487s1c1
Sequence:CCGGCCTTCACAACACCACTTCTAACTCGAGTTAGAAGTGGTGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000049
ASPA MISSION shRNA Bacterial Glycerol Stock
aspartoacylase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000049.1-1178s1c1
Sequence:CCGGGCCTTATTCAACTGCATACATCTCGAGATGTATGCAGTTGAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-876s1c1
Sequence:CCGGGCTGCTATCATCCATCCTAATCTCGAGATTAGGATGGATGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-809s1c1
Sequence:CCGGCTGCGCCATTGAGGTCTATAACTCGAGTTATAGACCTCAATGGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-609s1c1
Sequence:CCGGCCCTGCTACGTTTATCTGATTCTCGAGAATCAGATAAACGTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-201s1c1
Sequence:CCGGGCTATCTTTGGAGGAACCCATCTCGAGATGGGTTCCTCCAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000049
ASPA MISSION shRNA shRNA Plasmid DNA
aspartoacylase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000049.1-1178s1c1
Sequence:CCGGGCCTTATTCAACTGCATACATCTCGAGATGTATGCAGTTGAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-876s1c1
Sequence:CCGGGCTGCTATCATCCATCCTAATCTCGAGATTAGGATGGATGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-809s1c1
Sequence:CCGGCTGCGCCATTGAGGTCTATAACTCGAGTTATAGACCTCAATGGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-609s1c1
Sequence:CCGGCCCTGCTACGTTTATCTGATTCTCGAGAATCAGATAAACGTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-201s1c1
Sequence:CCGGGCTATCTTTGGAGGAACCCATCTCGAGATGGGTTCCTCCAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000049
ASPA MISSION shRNA Lentiviral Transduction Particles
aspartoacylase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000049.1-1178s1c1
Sequence:CCGGGCCTTATTCAACTGCATACATCTCGAGATGTATGCAGTTGAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-876s1c1
Sequence:CCGGGCTGCTATCATCCATCCTAATCTCGAGATTAGGATGGATGATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-809s1c1
Sequence:CCGGCTGCGCCATTGAGGTCTATAACTCGAGTTATAGACCTCAATGGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-609s1c1
Sequence:CCGGCCCTGCTACGTTTATCTGATTCTCGAGAATCAGATAAACGTAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000049.1-201s1c1
Sequence:CCGGGCTATCTTTGGAGGAACCCATCTCGAGATGGGTTCCTCCAAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks