EMAIL THIS PAGE TO A FRIEND

ASPDH

aspartate dehydrogenase domain containing

68 Gene Product Result for
UniProtKB ID: A6ND91, Q6NZ37
Gene ID:
Mouse(68352) aspartate dehydrogenase domain containing
Rat(292875) aspartate dehydrogenase domain containing
Zebrafish(447919) aspartate dehydrogenase domain containing
domestic cat(101099166) aspartate dehydrogenase domain containing
cow(540860) aspartate dehydrogenase domain containing
dog(611841) aspartate dehydrogenase domain containing
sheep(101118046) aspartate dehydrogenase domain containing
domestic guinea pig(100719302) aspartate dehydrogenase domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001024656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024656 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024656 Rosetta Predictions human pricing
NM_001114598 Rosetta Predictions human pricing
NM_001009643 Rosetta Predictions rat pricing
NM_026690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073255 predicted 617
2 SASI_Hs01_00073256 predicted 501
3 SASI_Hs01_00073259 predicted 520
4 SASI_Hs02_00307211 predicted 523
5 SASI_Hs02_00307212 predicted 521
6 SASI_Hs02_00307213 predicted 572
7 SASI_Hs02_00307214 predicted 520
8 SASI_Hs02_00307215 predicted 526
9 SASI_Hs02_00307216 predicted 525
10 SASI_Hs02_00307217 predicted 584
11 SASI_Hs01_00073251 predicted 222
12 SASI_Hs01_00073252 predicted 375
13 SASI_Hs01_00073253 predicted 215
14 SASI_Hs01_00073254 predicted 380
15 SASI_Hs01_00073257 predicted 373
16 SASI_Hs01_00073258 predicted 215
17 SASI_Hs01_00073260 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326634 predicted 816
2 SASI_Hs02_00326635 predicted 697
3 SASI_Hs02_00326636 predicted 719
4 SASI_Hs02_00326637 predicted 718
5 SASI_Hs02_00326638 predicted 710
6 SASI_Hs02_00326639 predicted 768
7 SASI_Hs02_00326640 predicted 714
8 SASI_Hs02_00326641 predicted 721
9 SASI_Hs02_00326642 predicted 713
10 SASI_Hs02_00326643 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071428 predicted 231
2 SASI_Rn01_00071429 predicted 238
3 SASI_Rn01_00071432 predicted 243
4 SASI_Rn02_00199663 predicted 464
5 SASI_Rn01_00071433 predicted 631
6 SASI_Rn01_00071434 predicted 425
7 SASI_Rn01_00071435 predicted 283
8 SASI_Rn01_00071436 predicted 675
9 SASI_Rn01_00071437 predicted 302
10 SASI_Rn02_00199664 predicted 279
11 SASI_Rn01_00071430 predicted 671
12 SASI_Rn01_00071431 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035925 predicted 682
2 SASI_Mm01_00035926 predicted 248
3 SASI_Mm01_00035929 predicted 301
4 SASI_Mm01_00035930 predicted 686
5 SASI_Mm01_00035931 predicted 440
6 SASI_Mm02_00330726 predicted 237
7 SASI_Mm02_00330727 predicted 701
8 SASI_Mm01_00035934 predicted 653
9 SASI_Mm02_00330728 predicted 449
10 SASI_Mm02_00330729 predicted 700
11 SASI_Mm01_00035927 predicted 492
12 SASI_Mm01_00035928 predicted 297
13 SASI_Mm01_00035932 predicted 490
14 SASI_Mm01_00035933 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026690
ASPDH MISSION shRNA Bacterial Glycerol Stock
aspartate dehydrogenase domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-440s21c1
Sequence:CCGGAGTGAAGACATCAGCAGACTGCTCGAGCAGTCTGCTGATGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-659s21c1
Sequence:CCGGCTAGGCTTCGACCGTGTCATTCTCGAGAATGACACGGTCGAAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-694s21c1
Sequence:CCGGTGACCTTAGCCTCACCGACATCTCGAGATGTCGGTGAGGCTAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-138s21c1
Sequence:CCGGCAGAACTGGGCCTAGAACTTGCTCGAGCAAGTTCTAGGCCCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-248s21c1
Sequence:CCGGCACCCTGACCTTGTGGTAGAACTCGAGTTCTACCACAAGGTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026690
ASPDH MISSION shRNA shRNA Plasmid DNA
aspartate dehydrogenase domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-440s21c1
Sequence:CCGGAGTGAAGACATCAGCAGACTGCTCGAGCAGTCTGCTGATGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-659s21c1
Sequence:CCGGCTAGGCTTCGACCGTGTCATTCTCGAGAATGACACGGTCGAAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-694s21c1
Sequence:CCGGTGACCTTAGCCTCACCGACATCTCGAGATGTCGGTGAGGCTAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-138s21c1
Sequence:CCGGCAGAACTGGGCCTAGAACTTGCTCGAGCAAGTTCTAGGCCCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-248s21c1
Sequence:CCGGCACCCTGACCTTGTGGTAGAACTCGAGTTCTACCACAAGGTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026690
ASPDH MISSION shRNA Lentiviral Transduction Particles
aspartate dehydrogenase domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-440s21c1
Sequence:CCGGAGTGAAGACATCAGCAGACTGCTCGAGCAGTCTGCTGATGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-659s21c1
Sequence:CCGGCTAGGCTTCGACCGTGTCATTCTCGAGAATGACACGGTCGAAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-694s21c1
Sequence:CCGGTGACCTTAGCCTCACCGACATCTCGAGATGTCGGTGAGGCTAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-138s21c1
Sequence:CCGGCAGAACTGGGCCTAGAACTTGCTCGAGCAAGTTCTAGGCCCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026690.1-248s21c1
Sequence:CCGGCACCCTGACCTTGTGGTAGAACTCGAGTTCTACCACAAGGTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024656
ASPDH MISSION shRNA Bacterial Glycerol Stock
aspartate dehydrogenase domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-217s21c1
Sequence:CCGGCCCTGATCTGGTTGTGGAAGTCTCGAGACTTCCACAACCAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-272s21c1
Sequence:CCGGCAAATCCTGCGCCATGCCAATCTCGAGATTGGCATGGCGCAGGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-428s21c1
Sequence:CCGGCCGCGAAATTCCAACACCATGCTCGAGCATGGTGTTGGAATTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-377s21c1
Sequence:CCGGCCTTGCACTGTGCTCTACGAACTCGAGTTCGTAGAGCACAGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-511s21c1
Sequence:CCGGTGATACCAGCCTCACGGACATCTCGAGATGTCCGTGAGGCTGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024656
ASPDH MISSION shRNA shRNA Plasmid DNA
aspartate dehydrogenase domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-217s21c1
Sequence:CCGGCCCTGATCTGGTTGTGGAAGTCTCGAGACTTCCACAACCAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-272s21c1
Sequence:CCGGCAAATCCTGCGCCATGCCAATCTCGAGATTGGCATGGCGCAGGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-428s21c1
Sequence:CCGGCCGCGAAATTCCAACACCATGCTCGAGCATGGTGTTGGAATTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-377s21c1
Sequence:CCGGCCTTGCACTGTGCTCTACGAACTCGAGTTCGTAGAGCACAGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-511s21c1
Sequence:CCGGTGATACCAGCCTCACGGACATCTCGAGATGTCCGTGAGGCTGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024656
ASPDH MISSION shRNA Lentiviral Transduction Particles
aspartate dehydrogenase domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-217s21c1
Sequence:CCGGCCCTGATCTGGTTGTGGAAGTCTCGAGACTTCCACAACCAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-272s21c1
Sequence:CCGGCAAATCCTGCGCCATGCCAATCTCGAGATTGGCATGGCGCAGGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-428s21c1
Sequence:CCGGCCGCGAAATTCCAACACCATGCTCGAGCATGGTGTTGGAATTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-377s21c1
Sequence:CCGGCCTTGCACTGTGCTCTACGAACTCGAGTTCGTAGAGCACAGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024656.2-511s21c1
Sequence:CCGGTGATACCAGCCTCACGGACATCTCGAGATGTCCGTGAGGCTGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks