EMAIL THIS PAGE TO A FRIEND

ASPG

asparaginase homolog (S. cerevisiae)

115 Gene Product Result for
Synonyms: C14orf76 GPA/WT
UniProtKB ID: Q86U10, B9EGQ2, Q8IV80
Gene ID:
Mouse(104816) asparaginase homolog (S. cerevisiae)
Rat(246266) asparaginase homolog (S. cerevisiae)
naked mole-rat(101706066) asparaginase homolog (S. cerevisiae)
domestic guinea pig(100723883) asparaginase homolog (S. cerevisiae)
sheep(101103429) asparaginase homolog (S. cerevisiae)
Zebrafish(100124594) asparaginase homolog (S. cerevisiae)
cow(505486) asparaginase homolog (S. cerevisiae)
domestic cat(101086401) asparaginase homolog (S. cerevisiae)
dog(612664) asparaginase homolog (S. cerevisiae)
chicken(772201) asparaginase homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080464 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080464 Rosetta Predictions human pricing
XM_370777 Rosetta Predictions human pricing
XM_930559 Rosetta Predictions human pricing
XM_935430 Rosetta Predictions human pricing
XM_935431 Rosetta Predictions human pricing
NM_144750 Rosetta Predictions rat pricing
NM_001081169 Rosetta Predictions mouse pricing
XM_203596 Rosetta Predictions mouse pricing
XM_902090 Rosetta Predictions mouse pricing
XM_902095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315086 predicted 843
2 SASI_Hs02_00315087 predicted 254
3 SASI_Hs02_00315088 predicted 679
4 SASI_Hs02_00315089 predicted 922
5 SASI_Hs02_00315090 predicted 545
6 SASI_Hs02_00315091 predicted 1235
7 SASI_Hs02_00315092 predicted 1008
8 SASI_Hs02_00315093 predicted 1486
9 SASI_Hs02_00315094 predicted 315
10 SASI_Hs02_00315095 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269646 predicted 847
2 SASI_Hs01_00269647 predicted 261
3 SASI_Hs01_00269648 predicted 310
4 SASI_Hs01_00269649 predicted 681
5 SASI_Hs01_00269650 predicted 546
6 SASI_Hs01_00269651 predicted 1229
7 SASI_Hs01_00269652 predicted 1006
8 SASI_Hs01_00269653 predicted 1481
9 SASI_Hs01_00269654 predicted 319
10 SASI_Hs01_00269655 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261147 predicted 847
2 SASI_Hs01_00261148 predicted 255
3 SASI_Hs01_00261149 predicted 310
4 SASI_Hs01_00261150 predicted 683
5 SASI_Hs01_00261151 predicted 553
6 SASI_Hs01_00261152 predicted 1226
7 SASI_Hs01_00261153 predicted 1010
8 SASI_Hs01_00261154 predicted 1489
9 SASI_Hs01_00261155 predicted 313
10 SASI_Hs01_00261156 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280215 predicted 602
2 SASI_Hs01_00280216 predicted 511
3 SASI_Hs01_00280217 predicted 397
4 SASI_Hs01_00280218 predicted 241
5 SASI_Hs01_00280219 predicted 715
6 SASI_Hs01_00280220 predicted 443
7 SASI_Hs01_00280221 predicted 392
8 SASI_Hs01_00280222 predicted 231
9 SASI_Hs01_00280223 predicted 713
10 SASI_Hs01_00280224 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276139 predicted 1619
2 SASI_Hs01_00276140 predicted 1032
3 SASI_Hs01_00276141 predicted 1081
4 SASI_Hs01_00276142 predicted 1450
5 SASI_Hs01_00276143 predicted 1695
6 SASI_Hs01_00276144 predicted 1326
7 SASI_Hs01_00276145 predicted 2003
8 SASI_Hs01_00276146 predicted 1778
9 SASI_Hs01_00276147 predicted 1095
10 SASI_Hs01_00276148 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034901 predicted 343
2 SASI_Rn01_00034902 predicted 944
3 SASI_Rn02_00268631 predicted 333
4 SASI_Rn01_00034903 predicted 1800
5 SASI_Rn01_00034904 predicted 954
6 SASI_Rn01_00034905 predicted 373
7 SASI_Rn01_00034906 predicted 196
8 SASI_Rn01_00034907 predicted 1448
9 SASI_Rn01_00034908 predicted 1791
10 SASI_Rn01_00034909 predicted 388
11 SASI_Rn01_00034910 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295861 predicted 457
2 SASI_Mm02_00295862 predicted 1377
3 SASI_Mm02_00295863 predicted 1475
4 SASI_Mm02_00295864 predicted 699
5 SASI_Mm02_00295865 predicted 1074
6 SASI_Mm02_00295866 predicted 517
7 SASI_Mm02_00295867 predicted 329
8 SASI_Mm02_00295868 predicted 1061
9 SASI_Mm02_00295869 predicted 979
10 SASI_Mm02_00295870 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279910 predicted 468
2 SASI_Mm01_00279911 predicted 1383
3 SASI_Mm01_00279912 predicted 1477
4 SASI_Mm01_00279913 predicted 706
5 SASI_Mm01_00279914 predicted 1079
6 SASI_Mm01_00279915 predicted 524
7 SASI_Mm01_00279916 predicted 334
8 SASI_Mm01_00279917 predicted 1068
9 SASI_Mm01_00279918 predicted 982
10 SASI_Mm01_00279919 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273339 predicted 1097
2 SASI_Mm01_00273340 predicted 465
3 SASI_Mm01_00273341 predicted 413
4 SASI_Mm01_00273342 predicted 708
5 SASI_Mm01_00273343 predicted 1150
6 SASI_Mm01_00273344 predicted 1016
7 SASI_Mm01_00273345 predicted 751
8 SASI_Mm01_00273346 predicted 753
9 SASI_Mm01_00273347 predicted 524
10 SASI_Mm01_00273348 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205597 predicted 245
2 SASI_Mm01_00205598 predicted 221
3 SASI_Mm01_00205599 predicted 246
4 SASI_Mm01_00205600 predicted 235
5 SASI_Mm01_00205601 predicted 400
6 SASI_Mm01_00205602 predicted 270
7 SASI_Mm01_00205603 predicted 285
8 SASI_Mm01_00205604 predicted 330
9 SASI_Mm01_00205605 predicted 288
10 SASI_Mm01_00205606 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081169
ASPG MISSION shRNA Bacterial Glycerol Stock
asparaginase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1596s21c1
Sequence:CCGGGATGGTCAGAGCCCACTATTGCTCGAGCAATAGTGGGCTCTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081169.1-2492s21c1
Sequence:CCGGGCTACTATGTTAGCGTCATTGCTCGAGCAATGACGCTAACATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1851s21c1
Sequence:CCGGGCCCTGCTACAGAGCTTTAAGCTCGAGCTTAAAGCTCTGTAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1069s21c1
Sequence:CCGGCCGAACAAGGCCTGATCATTGCTCGAGCAATGATCAGGCCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1477s21c1
Sequence:CCGGACCTAAACCTGAAGGACTATACTCGAGTATAGTCCTTCAGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081169
ASPG MISSION shRNA shRNA Plasmid DNA
asparaginase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1596s21c1
Sequence:CCGGGATGGTCAGAGCCCACTATTGCTCGAGCAATAGTGGGCTCTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081169.1-2492s21c1
Sequence:CCGGGCTACTATGTTAGCGTCATTGCTCGAGCAATGACGCTAACATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1851s21c1
Sequence:CCGGGCCCTGCTACAGAGCTTTAAGCTCGAGCTTAAAGCTCTGTAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1069s21c1
Sequence:CCGGCCGAACAAGGCCTGATCATTGCTCGAGCAATGATCAGGCCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1477s21c1
Sequence:CCGGACCTAAACCTGAAGGACTATACTCGAGTATAGTCCTTCAGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081169
ASPG MISSION shRNA Lentiviral Transduction Particles
asparaginase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1596s21c1
Sequence:CCGGGATGGTCAGAGCCCACTATTGCTCGAGCAATAGTGGGCTCTGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081169.1-2492s21c1
Sequence:CCGGGCTACTATGTTAGCGTCATTGCTCGAGCAATGACGCTAACATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1851s21c1
Sequence:CCGGGCCCTGCTACAGAGCTTTAAGCTCGAGCTTAAAGCTCTGTAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1069s21c1
Sequence:CCGGCCGAACAAGGCCTGATCATTGCTCGAGCAATGATCAGGCCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081169.1-1477s21c1
Sequence:CCGGACCTAAACCTGAAGGACTATACTCGAGTATAGTCCTTCAGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080464
ASPG MISSION shRNA Bacterial Glycerol Stock
asparaginase homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1016s21c1
Sequence:CCGGTCATCTCAGGCTTCGACATGACTCGAGTCATGTCGAAGCCTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-929s21c1
Sequence:CCGGGCCTGGTCATCGTCAACTGTACTCGAGTACAGTTGACGATGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1347s21c1
Sequence:CCGGGGTGGACTTTAACGGCCAAACCTCGAGGTTTGGCCGTTAAAGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1050s21c1
Sequence:CCGGCCTGGCCAAGCTATCGTATGTCTCGAGACATACGATAGCTTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-682s21c1
Sequence:CCGGGTGGGTGCTGACATCACAATCCTCGAGGATTGTGATGTCAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080464
ASPG MISSION shRNA shRNA Plasmid DNA
asparaginase homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1016s21c1
Sequence:CCGGTCATCTCAGGCTTCGACATGACTCGAGTCATGTCGAAGCCTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-929s21c1
Sequence:CCGGGCCTGGTCATCGTCAACTGTACTCGAGTACAGTTGACGATGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1347s21c1
Sequence:CCGGGGTGGACTTTAACGGCCAAACCTCGAGGTTTGGCCGTTAAAGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1050s21c1
Sequence:CCGGCCTGGCCAAGCTATCGTATGTCTCGAGACATACGATAGCTTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-682s21c1
Sequence:CCGGGTGGGTGCTGACATCACAATCCTCGAGGATTGTGATGTCAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080464
ASPG MISSION shRNA Lentiviral Transduction Particles
asparaginase homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1016s21c1
Sequence:CCGGTCATCTCAGGCTTCGACATGACTCGAGTCATGTCGAAGCCTGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-929s21c1
Sequence:CCGGGCCTGGTCATCGTCAACTGTACTCGAGTACAGTTGACGATGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1347s21c1
Sequence:CCGGGGTGGACTTTAACGGCCAAACCTCGAGGTTTGGCCGTTAAAGTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-1050s21c1
Sequence:CCGGCCTGGCCAAGCTATCGTATGTCTCGAGACATACGATAGCTTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080464.1-682s21c1
Sequence:CCGGGTGGGTGCTGACATCACAATCCTCGAGGATTGTGATGTCAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks