EMAIL THIS PAGE TO A FRIEND

ASPH

aspartate beta-hydroxylase

248 Gene Product Result for
Synonyms: AAH BAH CASQ2BP1 HAAH JCTN junctin
Gene ID:
Human(444) Summary: This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
Mouse(65973) aspartate-beta-hydroxylase
Rat(312981) aspartate-beta-hydroxylase
Zebrafish(323659) aspartate beta-hydroxylase
fruit fly(36778) Aspartyl beta-hydroxylase
cow(286771) aspartate beta-hydroxylase
Horse(100065909) aspartate beta-hydroxylase
domestic cat(101100695) aspartate beta-hydroxylase
dog(403846) aspartate beta-hydroxylase
chicken(421142) aspartate beta-hydroxylase
domestic guinea pig(100726813) aspartate beta-hydroxylase
naked mole-rat(101725986) aspartate beta-hydroxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108625 Anti-ASPH affinity isolated antibody horse, rat, mouse, rat, human, pig, bovine
western blot pricing
SAB2108626 Anti-ASPH IgG fraction of antiserum horse, human, rat, canine, mouse, rabbit, rat
immunohistochemistry, western blot pricing
A6985 Anti-ASPH (246-260) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A7110 Anti-ASPH (666-680) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV34195 Anti-ASPH (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, bovine, guinea pig, human, rat, horse
western blot pricing
AV51357 Anti-ASPH (AB2) antibody produced in rabbit IgG fraction of antiserum horse, canine, human, rabbit, mouse, rat, rabbit
immunohistochemistry, western blot pricing
SAB1405494 Anti-ASPH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV51356 Anti-ASPH antibody produced in rabbit affinity isolated antibody bovine, canine, human, mouse, horse, rat
western blot pricing
SAB2104643 Anti-ASPH antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
HPA059303 Anti-ASPH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA055161 Anti-ASPH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105140 Anti-ASPH, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1402121 Monoclonal Anti-ASPH antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004318 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068341 MISSION® esiRNA esiRNA human ASPH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004318 Rosetta Predictions human pricing
NM_020164 Rosetta Predictions human pricing
NM_032466 Rosetta Predictions human pricing
NM_032467 Rosetta Predictions human pricing
NM_032468 Rosetta Predictions human pricing
NM_001098239 Rosetta Predictions rat pricing
NM_023066 Rosetta Predictions mouse pricing
NM_133723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080265 predicted 2047
2 SASI_Hs01_00080266 predicted 1181
3 SASI_Hs01_00080267 predicted 1707
4 SASI_Hs01_00080268 predicted 1686
5 SASI_Hs01_00080269 predicted 1822
6 SASI_Hs01_00080271 predicted 687
7 SASI_Hs01_00080272 predicted 1521
8 SASI_Hs01_00080273 predicted 816
9 SASI_Hs02_00337354 predicted 816
10 SASI_Hs02_00337355 predicted 775
11 SASI_Hs01_00080270 predicted 835
12 SASI_Hs01_00080274 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152743 predicted 918
2 SASI_Hs01_00152744 predicted 796
3 SASI_Hs01_00152747 predicted 917
4 SASI_Hs01_00152748 predicted 1022
5 SASI_Hs02_00353067 predicted 923
6 SASI_Hs01_00152750 predicted 959
7 SASI_Hs02_00353068 predicted 979
8 SASI_Hs02_00353069 predicted 835
9 SASI_Hs01_00152751 predicted 808
10 SASI_Hs02_00353070 predicted 838
11 SASI_Hs01_00152745 predicted 952
12 SASI_Hs01_00152746 predicted 881
13 SASI_Hs01_00152749 predicted 830
14 SASI_Hs01_00152752 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068305 predicted 794
2 SASI_Hs02_00359912 predicted 881
3 SASI_Hs02_00359913 predicted 692
4 SASI_Hs01_00068308 predicted 760
5 SASI_Hs01_00068309 predicted 622
6 SASI_Hs02_00359914 predicted 657
7 SASI_Hs01_00068310 predicted 752
8 SASI_Hs01_00068311 predicted 568
9 SASI_Hs01_00068312 predicted 747
10 SASI_Hs01_00068313 predicted 746
11 SASI_Hs01_00068306 predicted 872
12 SASI_Hs01_00068307 predicted 825
13 SASI_Hs01_00068314 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060244 predicted 941
2 SASI_Hs01_00060245 predicted 828
3 SASI_Hs01_00060248 predicted 938
4 SASI_Hs01_00060249 predicted 1040
5 SASI_Hs02_00359915 predicted 948
6 SASI_Hs01_00060251 predicted 985
7 SASI_Hs02_00359916 predicted 1008
8 SASI_Hs02_00359917 predicted 860
9 SASI_Hs01_00060252 predicted 831
10 SASI_Hs02_00359918 predicted 857
11 SASI_Hs01_00060246 predicted 986
12 SASI_Hs01_00060247 predicted 910
13 SASI_Hs01_00060250 predicted 858
14 SASI_Hs01_00060253 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190916 predicted 865
2 SASI_Hs02_00359919 predicted 946
3 SASI_Hs02_00359920 predicted 757
4 SASI_Hs01_00190919 predicted 826
5 SASI_Hs01_00190920 predicted 682
6 SASI_Hs02_00359921 predicted 720
7 SASI_Hs01_00190921 predicted 817
8 SASI_Hs01_00190922 predicted 634
9 SASI_Hs01_00190923 predicted 815
10 SASI_Hs01_00190924 predicted 804
11 SASI_Hs01_00190917 predicted 941
12 SASI_Hs01_00190918 predicted 898
13 SASI_Hs01_00190925 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209101 predicted 548
2 SASI_Rn02_00209102 predicted 300
3 SASI_Rn02_00209103 predicted 486
4 SASI_Rn02_00209104 predicted 382
5 SASI_Rn02_00209105 predicted 508
6 SASI_Rn02_00209106 predicted 662
7 SASI_Rn02_00209107 predicted 517
8 SASI_Rn02_00209108 predicted 258
9 SASI_Rn02_00209109 predicted 1161
10 SASI_Rn02_00209110 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137394 predicted 1310
2 SASI_Mm01_00137395 predicted 1162
3 SASI_Mm01_00137396 predicted 1549
4 SASI_Mm01_00137397 predicted 2144
5 SASI_Mm01_00137398 predicted 1616
6 SASI_Mm01_00137399 predicted 2212
7 SASI_Mm01_00137400 predicted 1144
8 SASI_Mm01_00137401 predicted 1578
9 SASI_Mm01_00137403 predicted 2181
10 SASI_Mm02_00326790 predicted 982
11 SASI_Mm01_00137402 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181277 predicted 477
2 SASI_Mm02_00338701 predicted 221
3 SASI_Mm01_00181278 predicted 1235
4 SASI_Mm01_00181279 predicted 1197
5 SASI_Mm01_00181280 predicted 307
6 SASI_Mm01_00181281 predicted 245
7 SASI_Mm01_00181282 predicted 1210
8 SASI_Mm01_00181283 predicted 1208
9 SASI_Mm01_00181284 predicted 638
10 SASI_Mm02_00338702 predicted 440
11 SASI_Mm01_00181285 predicted 528
12 SASI_Mm01_00181286 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004318
VALIDATED
ASPH MISSION shRNA Bacterial Glycerol Stock
aspartate beta-hydroxylase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004318.3-2651s21c1
Sequence:CCGGTGACTTGCAGCCCGAGTAATTCTCGAGAATTACTCGGGCTGCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004318.3-436s21c1
Sequence:CCGGCGTGGTTTATGGTGATTGCATCTCGAGATGCAATCACCATAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-2012s21c1
Sequence:CCGGGGGCTACACAGAGTTAGTAAACTCGAGTTTACTAACTCTGTGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-2525s21c1
Sequence:CCGGACGCAGCCTTCCAGCAATTTACTCGAGTAAATTGCTGGAAGGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-1883s21c1
Sequence:CCGGTGGGAACAAAGAGGCATATAACTCGAGTTATATGCCTCTTTGTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-2280s1c1
Sequence:CCGGCGGCTGATATTCATCGTGGATCTCGAGATCCACGATGAATATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-924s1c1
Sequence:CCGGCCTGAGGATAATCCTGTAGAACTCGAGTTCTACAGGATTATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-1601s1c1
Sequence:CCGGCCCATATTTAAAGGAAGGAATCTCGAGATTCCTTCCTTTAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-244s1c1
Sequence:CCGGCGTGGTTTATGGTGATTGCATCTCGAGATGCAATCACCATAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-1761s1c1
Sequence:CCGGCGCTCACTCTACAATGTGAATCTCGAGATTCACATTGTAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004318
VALIDATED
ASPH MISSION shRNA shRNA Plasmid DNA
aspartate beta-hydroxylase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004318.3-2651s21c1
Sequence:CCGGTGACTTGCAGCCCGAGTAATTCTCGAGAATTACTCGGGCTGCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004318.3-436s21c1
Sequence:CCGGCGTGGTTTATGGTGATTGCATCTCGAGATGCAATCACCATAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-2012s21c1
Sequence:CCGGGGGCTACACAGAGTTAGTAAACTCGAGTTTACTAACTCTGTGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-2525s21c1
Sequence:CCGGACGCAGCCTTCCAGCAATTTACTCGAGTAAATTGCTGGAAGGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-1883s21c1
Sequence:CCGGTGGGAACAAAGAGGCATATAACTCGAGTTATATGCCTCTTTGTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-2280s1c1
Sequence:CCGGCGGCTGATATTCATCGTGGATCTCGAGATCCACGATGAATATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-924s1c1
Sequence:CCGGCCTGAGGATAATCCTGTAGAACTCGAGTTCTACAGGATTATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-1601s1c1
Sequence:CCGGCCCATATTTAAAGGAAGGAATCTCGAGATTCCTTCCTTTAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-244s1c1
Sequence:CCGGCGTGGTTTATGGTGATTGCATCTCGAGATGCAATCACCATAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-1761s1c1
Sequence:CCGGCGCTCACTCTACAATGTGAATCTCGAGATTCACATTGTAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004318
VALIDATED
ASPH MISSION shRNA Lentiviral Transduction Particles
aspartate beta-hydroxylase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004318.3-2651s21c1
Sequence:CCGGTGACTTGCAGCCCGAGTAATTCTCGAGAATTACTCGGGCTGCAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004318.3-436s21c1
Sequence:CCGGCGTGGTTTATGGTGATTGCATCTCGAGATGCAATCACCATAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-2012s21c1
Sequence:CCGGGGGCTACACAGAGTTAGTAAACTCGAGTTTACTAACTCTGTGTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-2525s21c1
Sequence:CCGGACGCAGCCTTCCAGCAATTTACTCGAGTAAATTGCTGGAAGGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004318.3-1883s21c1
Sequence:CCGGTGGGAACAAAGAGGCATATAACTCGAGTTATATGCCTCTTTGTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-2280s1c1
Sequence:CCGGCGGCTGATATTCATCGTGGATCTCGAGATCCACGATGAATATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-924s1c1
Sequence:CCGGCCTGAGGATAATCCTGTAGAACTCGAGTTCTACAGGATTATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-1601s1c1
Sequence:CCGGCCCATATTTAAAGGAAGGAATCTCGAGATTCCTTCCTTTAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-244s1c1
Sequence:CCGGCGTGGTTTATGGTGATTGCATCTCGAGATGCAATCACCATAAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004318.2-1761s1c1
Sequence:CCGGCGCTCACTCTACAATGTGAATCTCGAGATTCACATTGTAGAGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023066
VALIDATED
ASPH MISSION shRNA Bacterial Glycerol Stock
aspartate beta-hydroxylase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-1006s21c1
Sequence:CCGGGACTATGATGAACCAGTATATCTCGAGATATACTGGTTCATCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-1591s21c1
Sequence:CCGGGTTTACGAAGAGGTGCTAAATCTCGAGATTTAGCACCTCTTCGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023066.2-2761s21c1
Sequence:CCGGACATGGAGGATATACTATATACTCGAGTATATAGTATATCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-2357s21c1
Sequence:CCGGCCTCGTCTTTCCGGCTGATATCTCGAGATATCAGCCGGAAAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-464s21c1
Sequence:CCGGGGTTTGACTTGGTCGATTATGCTCGAGCATAATCGACCAAGTCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023066.1-3533s1c1
Sequence:CCGGGCTGAGAAAGAGCAGTAGAAACTCGAGTTTCTACTGCTCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023066.1-2081s1c1
Sequence:CCGGCCGAAACAACAGGATGCAGAACTCGAGTTCTGCATCCTGTTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023066.1-1467s1c1
Sequence:CCGGCCCTAGTGATACTACCTTAAACTCGAGTTTAAGGTAGTATCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023066.1-785s1c1
Sequence:CCGGCCGGGACAGTTCATGAAGAAACTCGAGTTTCTTCATGAACTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023066.1-835s1c1
Sequence:CCGGGCATCGCAGAACCATCCAAATCTCGAGATTTGGATGGTTCTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023066
VALIDATED
ASPH MISSION shRNA shRNA Plasmid DNA
aspartate beta-hydroxylase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-1006s21c1
Sequence:CCGGGACTATGATGAACCAGTATATCTCGAGATATACTGGTTCATCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-1591s21c1
Sequence:CCGGGTTTACGAAGAGGTGCTAAATCTCGAGATTTAGCACCTCTTCGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023066.2-2761s21c1
Sequence:CCGGACATGGAGGATATACTATATACTCGAGTATATAGTATATCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-2357s21c1
Sequence:CCGGCCTCGTCTTTCCGGCTGATATCTCGAGATATCAGCCGGAAAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-464s21c1
Sequence:CCGGGGTTTGACTTGGTCGATTATGCTCGAGCATAATCGACCAAGTCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023066.1-3533s1c1
Sequence:CCGGGCTGAGAAAGAGCAGTAGAAACTCGAGTTTCTACTGCTCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023066.1-2081s1c1
Sequence:CCGGCCGAAACAACAGGATGCAGAACTCGAGTTCTGCATCCTGTTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023066.1-1467s1c1
Sequence:CCGGCCCTAGTGATACTACCTTAAACTCGAGTTTAAGGTAGTATCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023066.1-785s1c1
Sequence:CCGGCCGGGACAGTTCATGAAGAAACTCGAGTTTCTTCATGAACTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023066.1-835s1c1
Sequence:CCGGGCATCGCAGAACCATCCAAATCTCGAGATTTGGATGGTTCTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023066
VALIDATED
ASPH MISSION shRNA Lentiviral Transduction Particles
aspartate beta-hydroxylase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-1006s21c1
Sequence:CCGGGACTATGATGAACCAGTATATCTCGAGATATACTGGTTCATCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-1591s21c1
Sequence:CCGGGTTTACGAAGAGGTGCTAAATCTCGAGATTTAGCACCTCTTCGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023066.2-2761s21c1
Sequence:CCGGACATGGAGGATATACTATATACTCGAGTATATAGTATATCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-2357s21c1
Sequence:CCGGCCTCGTCTTTCCGGCTGATATCTCGAGATATCAGCCGGAAAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023066.2-464s21c1
Sequence:CCGGGGTTTGACTTGGTCGATTATGCTCGAGCATAATCGACCAAGTCAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023066.1-3533s1c1
Sequence:CCGGGCTGAGAAAGAGCAGTAGAAACTCGAGTTTCTACTGCTCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023066.1-2081s1c1
Sequence:CCGGCCGAAACAACAGGATGCAGAACTCGAGTTCTGCATCCTGTTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023066.1-1467s1c1
Sequence:CCGGCCCTAGTGATACTACCTTAAACTCGAGTTTAAGGTAGTATCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023066.1-785s1c1
Sequence:CCGGCCGGGACAGTTCATGAAGAAACTCGAGTTTCTTCATGAACTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023066.1-835s1c1
Sequence:CCGGGCATCGCAGAACCATCCAAATCTCGAGATTTGGATGGTTCTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks