EMAIL THIS PAGE TO A FRIEND

ASPM

asp (abnormal spindle) homolog, microcephaly associated (Drosophila)

46 Gene Product Result for
Synonyms: ASP Calmbp1 MCPH5
Gene ID:
Human(259266) Summary: This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Mouse(12316) asp (abnormal spindle)-like, microcephaly associated (Drosophila)
Rat(289054) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
naked mole-rat(101714580) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
domestic guinea pig(100713679) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
sheep(443284) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Zebrafish(554173) asp (abnormal spindle)-like, microcephaly associated (Drosophila)
cow(534849) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
domestic cat(493695) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
dog(480009) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
chicken(424354) asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018136 Rosetta Predictions human pricing
NM_001105955 Rosetta Predictions rat pricing
NM_009791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144819 predicted 4697
2 SASI_Hs01_00144820 predicted 5315
3 SASI_Hs01_00144821 predicted 2671
4 SASI_Hs01_00144823 predicted 2562
5 SASI_Hs02_00351353 predicted 2708
6 SASI_Hs01_00144825 predicted 1778
7 SASI_Hs02_00351354 predicted 939
8 SASI_Hs01_00144827 predicted 7329
9 SASI_Hs01_00144828 predicted 2581
10 SASI_Hs02_00351355 predicted 4811
11 SASI_Hs01_00144822 predicted 6191
12 SASI_Hs01_00144824 predicted 5580
13 SASI_Hs01_00144826 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214192 predicted 5129
2 SASI_Rn02_00214193 predicted 5026
3 SASI_Rn02_00214194 predicted 3270
4 SASI_Rn02_00214195 predicted 9289
5 SASI_Rn02_00214196 predicted 7473
6 SASI_Rn02_00214197 predicted 4947
7 SASI_Rn02_00214198 predicted 5496
8 SASI_Rn02_00214199 predicted 8478
9 SASI_Rn02_00214200 predicted 3480
10 SASI_Rn02_00214201 predicted 6156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147130 predicted 7268
2 SASI_Mm02_00317042 predicted 9040
3 SASI_Mm01_00147132 predicted 7544
4 SASI_Mm01_00147133 predicted 3488
5 SASI_Mm01_00147134 predicted 1236
6 SASI_Mm02_00317043 predicted 5765
7 SASI_Mm01_00147135 predicted 435
8 SASI_Mm02_00317044 predicted 6472
9 SASI_Mm01_00147137 predicted 8725
10 SASI_Mm01_00147139 predicted 6672
11 SASI_Mm01_00147131 predicted 9363
12 SASI_Mm01_00147136 predicted 6150
13 SASI_Mm01_00147138 predicted 3505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018136
VALIDATED
ASPM MISSION shRNA Bacterial Glycerol Stock
asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018136.2-2309s1c1
Sequence:CCGGGCCGTTTGTTTACTTCTGAAACTCGAGTTTCAGAAGTAAACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018136.2-10178s1c1
Sequence:CCGGCCAAAGTTGTTGACCGTATTTCTCGAGAAATACGGTCAACAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-396s1c1
Sequence:CCGGCCAAGCTATATTACTAGGAAACTCGAGTTTCCTAGTAATATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-2993s1c1
Sequence:CCGGCGGCAATAAGTCGTCTTCAAACTCGAGTTTGAAGACGACTTATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-4591s1c1
Sequence:CCGGCGCACCAACTATTTGCAGAAACTCGAGTTTCTGCAAATAGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018136.4-6453s21c1
Sequence:CCGGTATAGAGCTTCAGCTATTATACTCGAGTATAATAGCTGAAGCTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-2566s21c1
Sequence:CCGGGCCGTTTGTTTACTTCTGAAACTCGAGTTTCAGAAGTAAACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-10435s21c1
Sequence:CCGGCCAAAGTTGTTGACCGTATTTCTCGAGAAATACGGTCAACAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-9664s21c1
Sequence:CCGGATGCTAACAAGCAGGTTAATTCTCGAGAATTAACCTGCTTGTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-10736s21c1
Sequence:CCGGAGCCAATCATGAGTACGTAAACTCGAGTTTACGTACTCATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018136
VALIDATED
ASPM MISSION shRNA shRNA Plasmid DNA
asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018136.2-2309s1c1
Sequence:CCGGGCCGTTTGTTTACTTCTGAAACTCGAGTTTCAGAAGTAAACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018136.2-10178s1c1
Sequence:CCGGCCAAAGTTGTTGACCGTATTTCTCGAGAAATACGGTCAACAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-396s1c1
Sequence:CCGGCCAAGCTATATTACTAGGAAACTCGAGTTTCCTAGTAATATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-2993s1c1
Sequence:CCGGCGGCAATAAGTCGTCTTCAAACTCGAGTTTGAAGACGACTTATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-4591s1c1
Sequence:CCGGCGCACCAACTATTTGCAGAAACTCGAGTTTCTGCAAATAGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018136.4-6453s21c1
Sequence:CCGGTATAGAGCTTCAGCTATTATACTCGAGTATAATAGCTGAAGCTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-2566s21c1
Sequence:CCGGGCCGTTTGTTTACTTCTGAAACTCGAGTTTCAGAAGTAAACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-10435s21c1
Sequence:CCGGCCAAAGTTGTTGACCGTATTTCTCGAGAAATACGGTCAACAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-9664s21c1
Sequence:CCGGATGCTAACAAGCAGGTTAATTCTCGAGAATTAACCTGCTTGTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-10736s21c1
Sequence:CCGGAGCCAATCATGAGTACGTAAACTCGAGTTTACGTACTCATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018136
VALIDATED
ASPM MISSION shRNA Lentiviral Transduction Particles
asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018136.2-2309s1c1
Sequence:CCGGGCCGTTTGTTTACTTCTGAAACTCGAGTTTCAGAAGTAAACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018136.2-10178s1c1
Sequence:CCGGCCAAAGTTGTTGACCGTATTTCTCGAGAAATACGGTCAACAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-396s1c1
Sequence:CCGGCCAAGCTATATTACTAGGAAACTCGAGTTTCCTAGTAATATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-2993s1c1
Sequence:CCGGCGGCAATAAGTCGTCTTCAAACTCGAGTTTGAAGACGACTTATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018136.2-4591s1c1
Sequence:CCGGCGCACCAACTATTTGCAGAAACTCGAGTTTCTGCAAATAGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018136.4-6453s21c1
Sequence:CCGGTATAGAGCTTCAGCTATTATACTCGAGTATAATAGCTGAAGCTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-2566s21c1
Sequence:CCGGGCCGTTTGTTTACTTCTGAAACTCGAGTTTCAGAAGTAAACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-10435s21c1
Sequence:CCGGCCAAAGTTGTTGACCGTATTTCTCGAGAAATACGGTCAACAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-9664s21c1
Sequence:CCGGATGCTAACAAGCAGGTTAATTCTCGAGAATTAACCTGCTTGTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018136.4-10736s21c1
Sequence:CCGGAGCCAATCATGAGTACGTAAACTCGAGTTTACGTACTCATGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009791
VALIDATED
ASPM MISSION shRNA Bacterial Glycerol Stock
asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-9579s1c1
Sequence:CCGGGTCAGTGTAAACTGTTTAGATCTCGAGATCTAAACAGTTTACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009791.2-509s1c1
Sequence:CCGGCCAGGCTATATTACTAGGAAACTCGAGTTTCCTAGTAATATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-4729s1c1
Sequence:CCGGCCTGTGTTCTTCAGTCCTATTCTCGAGAATAGGACTGAAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009791.2-7342s1c1
Sequence:CCGGCCACCCTTTATGCCAAGCATACTCGAGTATGCTTGGCATAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-6180s1c1
Sequence:CCGGGCGGTCACTATACAGTCTAAACTCGAGTTTAGACTGTATAGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-4751s21c1
Sequence:CCGGCCTGTGTTCTTCAGTCCTATTCTCGAGAATAGGACTGAAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-9601s21c1
Sequence:CCGGGTCAGTGTAAACTGTTTAGATCTCGAGATCTAAACAGTTTACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-7271s21c1
Sequence:CCGGCCCTTATTCAGAGTCAATTTACTCGAGTAAATTGACTCTGAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009791.4-6505s21c1
Sequence:CCGGGTGAGATACAGAGCGTATTATCTCGAGATAATACGCTCTGTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-6555s21c1
Sequence:CCGGGAGGACTTTGAAGGCTATTAACTCGAGTTAATAGCCTTCAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009791
VALIDATED
ASPM MISSION shRNA shRNA Plasmid DNA
asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-9579s1c1
Sequence:CCGGGTCAGTGTAAACTGTTTAGATCTCGAGATCTAAACAGTTTACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009791.2-509s1c1
Sequence:CCGGCCAGGCTATATTACTAGGAAACTCGAGTTTCCTAGTAATATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-4729s1c1
Sequence:CCGGCCTGTGTTCTTCAGTCCTATTCTCGAGAATAGGACTGAAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009791.2-7342s1c1
Sequence:CCGGCCACCCTTTATGCCAAGCATACTCGAGTATGCTTGGCATAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-6180s1c1
Sequence:CCGGGCGGTCACTATACAGTCTAAACTCGAGTTTAGACTGTATAGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-4751s21c1
Sequence:CCGGCCTGTGTTCTTCAGTCCTATTCTCGAGAATAGGACTGAAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-9601s21c1
Sequence:CCGGGTCAGTGTAAACTGTTTAGATCTCGAGATCTAAACAGTTTACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-7271s21c1
Sequence:CCGGCCCTTATTCAGAGTCAATTTACTCGAGTAAATTGACTCTGAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009791.4-6505s21c1
Sequence:CCGGGTGAGATACAGAGCGTATTATCTCGAGATAATACGCTCTGTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-6555s21c1
Sequence:CCGGGAGGACTTTGAAGGCTATTAACTCGAGTTAATAGCCTTCAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009791
VALIDATED
ASPM MISSION shRNA Lentiviral Transduction Particles
asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-9579s1c1
Sequence:CCGGGTCAGTGTAAACTGTTTAGATCTCGAGATCTAAACAGTTTACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009791.2-509s1c1
Sequence:CCGGCCAGGCTATATTACTAGGAAACTCGAGTTTCCTAGTAATATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-4729s1c1
Sequence:CCGGCCTGTGTTCTTCAGTCCTATTCTCGAGAATAGGACTGAAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009791.2-7342s1c1
Sequence:CCGGCCACCCTTTATGCCAAGCATACTCGAGTATGCTTGGCATAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009791.2-6180s1c1
Sequence:CCGGGCGGTCACTATACAGTCTAAACTCGAGTTTAGACTGTATAGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-4751s21c1
Sequence:CCGGCCTGTGTTCTTCAGTCCTATTCTCGAGAATAGGACTGAAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-9601s21c1
Sequence:CCGGGTCAGTGTAAACTGTTTAGATCTCGAGATCTAAACAGTTTACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-7271s21c1
Sequence:CCGGCCCTTATTCAGAGTCAATTTACTCGAGTAAATTGACTCTGAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009791.4-6505s21c1
Sequence:CCGGGTGAGATACAGAGCGTATTATCTCGAGATAATACGCTCTGTATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009791.4-6555s21c1
Sequence:CCGGGAGGACTTTGAAGGCTATTAACTCGAGTTAATAGCCTTCAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks