EMAIL THIS PAGE TO A FRIEND

ASPN

asporin

52 Gene Product Result for
Synonyms: OS3 PLAP-1 PLAP1 SLRR1C
UniProtKB ID: Q9BXN1, Q5TBF3, Q96K79, Q96LD0, Q9NXP3
Gene ID:
Human(54829) Summary: This gene encodes a cartilage extracellular protein that is member of the small leucine-rich proteoglycan family. The encoded protein may regulate chondrogenesis by inhibiting transforming growth factor-beta 1-induced gene expression in cartilage. This protein also binds collagen and calcium and may induce collagen mineralization. Polymorphisms in the aspartic acid repeat region of this gene are associated with a susceptibility to osteoarthritis. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
Mouse(66695) asporin
Rat(306805) asporin
Zebrafish(65228) asporin (LRR class 1)
cow(507990) asporin
chicken(415954) asporin
dog(610685) asporin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017680 Rosetta Predictions human pricing
NM_001014008 Rosetta Predictions rat pricing
NM_025711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084904 predicted 758
2 SASI_Hs01_00084905 predicted 653
3 SASI_Hs01_00084906 predicted 851
4 SASI_Hs01_00084907 predicted 818
5 SASI_Hs01_00084908 predicted 722
6 SASI_Hs01_00084909 predicted 705
7 SASI_Hs01_00084910 predicted 1373
8 SASI_Hs01_00084911 predicted 623
9 SASI_Hs01_00084912 predicted 686
10 SASI_Hs01_00084913 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103590 predicted 687
2 SASI_Rn01_00103591 predicted 710
3 SASI_Rn01_00103592 predicted 562
4 SASI_Rn01_00103594 predicted 636
5 SASI_Rn01_00103595 predicted 703
6 SASI_Rn01_00103596 predicted 636
7 SASI_Rn01_00103597 predicted 1298
8 SASI_Rn01_00103598 predicted 645
9 SASI_Rn01_00103599 predicted 672
10 SASI_Rn02_00201379 predicted 594
11 SASI_Rn01_00103593 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178250 predicted 700
2 SASI_Mm01_00178251 predicted 556
3 SASI_Mm01_00178252 predicted 649
4 SASI_Mm01_00178253 predicted 637
5 SASI_Mm02_00328895 predicted 302
6 SASI_Mm01_00178254 predicted 657
7 SASI_Mm01_00178255 predicted 1388
8 SASI_Mm01_00178256 predicted 1419
9 SASI_Mm01_00178257 predicted 786
10 SASI_Mm01_00178258 predicted 626
11 SASI_Mm01_00178249 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025711
VALIDATED
ASPN MISSION shRNA Bacterial Glycerol Stock
asporin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-944s21c1
Sequence:CCGGGGTGGAACTTGAAGATCTTAACTCGAGTTAAGATCTTCAAGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-238s21c1
Sequence:CCGGGCTCTGCCAAACCCTTCTTTACTCGAGTAAAGAAGGGTTTGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-1260s21c1
Sequence:CCGGCCTGCAACATTTCGTTGTGTTCTCGAGAACACAACGAAATGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-465s21c1
Sequence:CCGGGTTCCAAACAACATTCCATTTCTCGAGAAATGGAATGTTGTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-628s21c1
Sequence:CCGGAGAAATTGAGAAGGCTATATTCTCGAGAATATAGCCTTCTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-1817s1c1
Sequence:CCGGGCTTCAAGTATTCACAGATAACTCGAGTTATCTGTGAATACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-463s1c1
Sequence:CCGGCGGTTCCAAACAACATTCCATCTCGAGATGGAATGTTGTTTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-1260s1c1
Sequence:CCGGCCTGCAACATTTCGTTGTGTTCTCGAGAACACAACGAAATGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-238s1c1
Sequence:CCGGGCTCTGCCAAACCCTTCTTTACTCGAGTAAAGAAGGGTTTGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-465s1c1
Sequence:CCGGGTTCCAAACAACATTCCATTTCTCGAGAAATGGAATGTTGTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025711
VALIDATED
ASPN MISSION shRNA shRNA Plasmid DNA
asporin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-944s21c1
Sequence:CCGGGGTGGAACTTGAAGATCTTAACTCGAGTTAAGATCTTCAAGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-238s21c1
Sequence:CCGGGCTCTGCCAAACCCTTCTTTACTCGAGTAAAGAAGGGTTTGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-1260s21c1
Sequence:CCGGCCTGCAACATTTCGTTGTGTTCTCGAGAACACAACGAAATGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-465s21c1
Sequence:CCGGGTTCCAAACAACATTCCATTTCTCGAGAAATGGAATGTTGTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-628s21c1
Sequence:CCGGAGAAATTGAGAAGGCTATATTCTCGAGAATATAGCCTTCTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-1817s1c1
Sequence:CCGGGCTTCAAGTATTCACAGATAACTCGAGTTATCTGTGAATACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-463s1c1
Sequence:CCGGCGGTTCCAAACAACATTCCATCTCGAGATGGAATGTTGTTTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-1260s1c1
Sequence:CCGGCCTGCAACATTTCGTTGTGTTCTCGAGAACACAACGAAATGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-238s1c1
Sequence:CCGGGCTCTGCCAAACCCTTCTTTACTCGAGTAAAGAAGGGTTTGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-465s1c1
Sequence:CCGGGTTCCAAACAACATTCCATTTCTCGAGAAATGGAATGTTGTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025711
VALIDATED
ASPN MISSION shRNA Lentiviral Transduction Particles
asporin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-944s21c1
Sequence:CCGGGGTGGAACTTGAAGATCTTAACTCGAGTTAAGATCTTCAAGTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-238s21c1
Sequence:CCGGGCTCTGCCAAACCCTTCTTTACTCGAGTAAAGAAGGGTTTGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-1260s21c1
Sequence:CCGGCCTGCAACATTTCGTTGTGTTCTCGAGAACACAACGAAATGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-465s21c1
Sequence:CCGGGTTCCAAACAACATTCCATTTCTCGAGAAATGGAATGTTGTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025711.2-628s21c1
Sequence:CCGGAGAAATTGAGAAGGCTATATTCTCGAGAATATAGCCTTCTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-1817s1c1
Sequence:CCGGGCTTCAAGTATTCACAGATAACTCGAGTTATCTGTGAATACTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-463s1c1
Sequence:CCGGCGGTTCCAAACAACATTCCATCTCGAGATGGAATGTTGTTTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-1260s1c1
Sequence:CCGGCCTGCAACATTTCGTTGTGTTCTCGAGAACACAACGAAATGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-238s1c1
Sequence:CCGGGCTCTGCCAAACCCTTCTTTACTCGAGTAAAGAAGGGTTTGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025711.2-465s1c1
Sequence:CCGGGTTCCAAACAACATTCCATTTCTCGAGAAATGGAATGTTGTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017680
VALIDATED
ASPN MISSION shRNA Bacterial Glycerol Stock
asporin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017680.3-975s21c1
Sequence:CCGGTGGAGCTTCACTTAGATTATACTCGAGTATAATCTAAGTGAAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017680.3-1394s21c1
Sequence:CCGGGTAATTGGTAATGTCCATTTACTCGAGTAAATGGACATTACCAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017680.3-1442s21c1
Sequence:CCGGGGAATACTTGAACTCTATTAACTCGAGTTAATAGAGTTCAAGTATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017680.3-1967s1c1
Sequence:CCGGGCCTTCAGTAAATGTTCATTACTCGAGTAATGAACATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-1300s1c1
Sequence:CCGGCCCGGTGAAATACTGGGAAATCTCGAGATTTCCCAGTATTTCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-533s1c1
Sequence:CCGGCCAACCAACATTCCATTTGATCTCGAGATCAAATGGAATGTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-860s1c1
Sequence:CCGGCCTCTTGATAATAATGGGATACTCGAGTATCCCATTATTATCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-859s1c1
Sequence:CCGGCCCTCTTGATAATAATGGGATCTCGAGATCCCATTATTATCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017680
VALIDATED
ASPN MISSION shRNA shRNA Plasmid DNA
asporin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017680.3-975s21c1
Sequence:CCGGTGGAGCTTCACTTAGATTATACTCGAGTATAATCTAAGTGAAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017680.3-1394s21c1
Sequence:CCGGGTAATTGGTAATGTCCATTTACTCGAGTAAATGGACATTACCAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017680.3-1442s21c1
Sequence:CCGGGGAATACTTGAACTCTATTAACTCGAGTTAATAGAGTTCAAGTATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017680.3-1967s1c1
Sequence:CCGGGCCTTCAGTAAATGTTCATTACTCGAGTAATGAACATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-1300s1c1
Sequence:CCGGCCCGGTGAAATACTGGGAAATCTCGAGATTTCCCAGTATTTCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-533s1c1
Sequence:CCGGCCAACCAACATTCCATTTGATCTCGAGATCAAATGGAATGTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-860s1c1
Sequence:CCGGCCTCTTGATAATAATGGGATACTCGAGTATCCCATTATTATCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-859s1c1
Sequence:CCGGCCCTCTTGATAATAATGGGATCTCGAGATCCCATTATTATCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017680
VALIDATED
ASPN MISSION shRNA Lentiviral Transduction Particles
asporin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017680.3-975s21c1
Sequence:CCGGTGGAGCTTCACTTAGATTATACTCGAGTATAATCTAAGTGAAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017680.3-1394s21c1
Sequence:CCGGGTAATTGGTAATGTCCATTTACTCGAGTAAATGGACATTACCAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017680.3-1442s21c1
Sequence:CCGGGGAATACTTGAACTCTATTAACTCGAGTTAATAGAGTTCAAGTATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017680.3-1967s1c1
Sequence:CCGGGCCTTCAGTAAATGTTCATTACTCGAGTAATGAACATTTACTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-1300s1c1
Sequence:CCGGCCCGGTGAAATACTGGGAAATCTCGAGATTTCCCAGTATTTCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-533s1c1
Sequence:CCGGCCAACCAACATTCCATTTGATCTCGAGATCAAATGGAATGTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-860s1c1
Sequence:CCGGCCTCTTGATAATAATGGGATACTCGAGTATCCCATTATTATCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017680.3-859s1c1
Sequence:CCGGCCCTCTTGATAATAATGGGATCTCGAGATCCCATTATTATCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks