EMAIL THIS PAGE TO A FRIEND

ASPRV1

aspartic peptidase, retroviral-like 1

79 Gene Product Result for
Synonyms: MUNO SASP SASPase Taps
UniProtKB ID: Q53RT3, Q8N5P2, Q96LT3, Q96N43
Gene ID:
Mouse(67855) aspartic peptidase, retroviral-like 1
cow(538522) aspartic peptidase, retroviral-like 1
domestic cat(101094412) aspartic peptidase, retroviral-like 1
dog(481416) aspartic peptidase, retroviral-like 1
naked mole-rat(101725908) aspartic peptidase, retroviral-like 1
domestic guinea pig(100719129) aspartic peptidase, retroviral-like 1
sheep(101115358) aspartic peptidase, retroviral-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152792 Rosetta Predictions human pricing
NM_026414 Rosetta Predictions mouse pricing
XM_888129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063373 predicted 1897
2 SASI_Hs01_00063374 predicted 1328
3 SASI_Hs01_00063375 predicted 1370
4 SASI_Hs01_00063376 predicted 947
5 SASI_Hs01_00063377 predicted 1215
6 SASI_Hs01_00063378 predicted 1146
7 SASI_Hs01_00063379 predicted 609
8 SASI_Hs01_00063380 predicted 1281
9 SASI_Hs01_00063381 predicted 866
10 SASI_Hs01_00063382 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330210 predicted 955
2 SASI_Mm02_00330211 predicted 308
3 SASI_Mm02_00330212 predicted 1118
4 SASI_Mm02_00330213 predicted 682
5 SASI_Mm02_00330214 predicted 344
6 SASI_Mm02_00330215 predicted 195
7 SASI_Mm02_00330216 predicted 334
8 SASI_Mm02_00330217 predicted 1252
9 SASI_Mm02_00330218 predicted 851
10 SASI_Mm02_00330219 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247218 predicted 955
2 SASI_Mm01_00247219 predicted 801
3 SASI_Mm01_00247220 predicted 308
4 SASI_Mm01_00247221 predicted 1121
5 SASI_Mm01_00247222 predicted 686
6 SASI_Mm01_00247223 predicted 353
7 SASI_Mm01_00247224 predicted 200
8 SASI_Mm01_00247225 predicted 344
9 SASI_Mm01_00247226 predicted 1259
10 SASI_Mm01_00247227 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152792
ASPRV1 MISSION shRNA Bacterial Glycerol Stock
aspartic peptidase, retroviral-like 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-1446s1c1
Sequence:CCGGCCACAATGCTATCCTGGACTTCTCGAGAAGTCCAGGATAGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-969s1c1
Sequence:CCGGCACCAAGCTAAGGTTCCTGAACTCGAGTTCAGGAACCTTAGCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1537s1c1
Sequence:CCGGGAGTTTGACCTGGAGCTCATACTCGAGTATGAGCTCCAGGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152792.1-1699s1c1
Sequence:CCGGCCAGTCTGCTTATCAACTCTTCTCGAGAAGAGTTGATAAGCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-963s1c1
Sequence:CCGGCCATATCACCAAGCTAAGGTTCTCGAGAACCTTAGCTTGGTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1414s1c1
Sequence:CCGGGAAGCCATCATTGGCACTGATCTCGAGATCAGTGCCAATGATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-1134s1c1
Sequence:CCGGCTTTGCCAACAGCATGGGTAACTCGAGTTACCCATGCTGTTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1488s1c1
Sequence:CCGGGAAAGGGAAGAAGTTTCGCCTCTCGAGAGGCGAAACTTCTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-765s1c1
Sequence:CCGGGCTCTGTGGGTTTCTCTTCTTCTCGAGAAGAAGAGAAACCCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-921s1c1
Sequence:CCGGGCTGCACAGCTTTGAAGTCATCTCGAGATGACTTCAAAGCTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1318s1c1
Sequence:CCGGGCTGAAATGAAGATCCTGGGTCTCGAGACCCAGGATCTTCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1128s1c1
Sequence:CCGGGATCGTCTTTGCCAACAGCATCTCGAGATGCTGTTGGCAAAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152792.1-1890s1c1
Sequence:CCGGCCAAGGAAGCTAGAAATGCTTCTCGAGAAGCATTTCTAGCTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152792
ASPRV1 MISSION shRNA shRNA Plasmid DNA
aspartic peptidase, retroviral-like 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-1446s1c1
Sequence:CCGGCCACAATGCTATCCTGGACTTCTCGAGAAGTCCAGGATAGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-969s1c1
Sequence:CCGGCACCAAGCTAAGGTTCCTGAACTCGAGTTCAGGAACCTTAGCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1537s1c1
Sequence:CCGGGAGTTTGACCTGGAGCTCATACTCGAGTATGAGCTCCAGGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152792.1-1699s1c1
Sequence:CCGGCCAGTCTGCTTATCAACTCTTCTCGAGAAGAGTTGATAAGCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-963s1c1
Sequence:CCGGCCATATCACCAAGCTAAGGTTCTCGAGAACCTTAGCTTGGTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1414s1c1
Sequence:CCGGGAAGCCATCATTGGCACTGATCTCGAGATCAGTGCCAATGATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-1134s1c1
Sequence:CCGGCTTTGCCAACAGCATGGGTAACTCGAGTTACCCATGCTGTTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1488s1c1
Sequence:CCGGGAAAGGGAAGAAGTTTCGCCTCTCGAGAGGCGAAACTTCTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-765s1c1
Sequence:CCGGGCTCTGTGGGTTTCTCTTCTTCTCGAGAAGAAGAGAAACCCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-921s1c1
Sequence:CCGGGCTGCACAGCTTTGAAGTCATCTCGAGATGACTTCAAAGCTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1318s1c1
Sequence:CCGGGCTGAAATGAAGATCCTGGGTCTCGAGACCCAGGATCTTCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1128s1c1
Sequence:CCGGGATCGTCTTTGCCAACAGCATCTCGAGATGCTGTTGGCAAAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152792.1-1890s1c1
Sequence:CCGGCCAAGGAAGCTAGAAATGCTTCTCGAGAAGCATTTCTAGCTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152792
ASPRV1 MISSION shRNA Lentiviral Transduction Particles
aspartic peptidase, retroviral-like 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-1446s1c1
Sequence:CCGGCCACAATGCTATCCTGGACTTCTCGAGAAGTCCAGGATAGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-969s1c1
Sequence:CCGGCACCAAGCTAAGGTTCCTGAACTCGAGTTCAGGAACCTTAGCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1537s1c1
Sequence:CCGGGAGTTTGACCTGGAGCTCATACTCGAGTATGAGCTCCAGGTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152792.1-1699s1c1
Sequence:CCGGCCAGTCTGCTTATCAACTCTTCTCGAGAAGAGTTGATAAGCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-963s1c1
Sequence:CCGGCCATATCACCAAGCTAAGGTTCTCGAGAACCTTAGCTTGGTGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1414s1c1
Sequence:CCGGGAAGCCATCATTGGCACTGATCTCGAGATCAGTGCCAATGATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152792.1-1134s1c1
Sequence:CCGGCTTTGCCAACAGCATGGGTAACTCGAGTTACCCATGCTGTTGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1488s1c1
Sequence:CCGGGAAAGGGAAGAAGTTTCGCCTCTCGAGAGGCGAAACTTCTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-765s1c1
Sequence:CCGGGCTCTGTGGGTTTCTCTTCTTCTCGAGAAGAAGAGAAACCCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-921s1c1
Sequence:CCGGGCTGCACAGCTTTGAAGTCATCTCGAGATGACTTCAAAGCTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1318s1c1
Sequence:CCGGGCTGAAATGAAGATCCTGGGTCTCGAGACCCAGGATCTTCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152792.1-1128s1c1
Sequence:CCGGGATCGTCTTTGCCAACAGCATCTCGAGATGCTGTTGGCAAAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152792.1-1890s1c1
Sequence:CCGGCCAAGGAAGCTAGAAATGCTTCTCGAGAAGCATTTCTAGCTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026414
ASPRV1 MISSION shRNA Bacterial Glycerol Stock
aspartic peptidase, retroviral-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-215s1c1
Sequence:CCGGCACAGAAATTAGCCTGGGCAACTCGAGTTGCCCAGGCTAATTTCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-137s1c1
Sequence:CCGGCCTGGATACTCTTCGTCCTTTCTCGAGAAAGGACGAAGAGTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-271s1c1
Sequence:CCGGCCAGCGCAGAAGAGGCTATTACTCGAGTAATAGCCTCTTCTGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-411s1c1
Sequence:CCGGGACCTGGAGCTTATTGAGGAACTCGAGTTCCTCAATAAGCTCCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-281s1c1
Sequence:CCGGAGAGGCTATTATTGGCACAGACTCGAGTCTGTGCCAATAATAGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026414
ASPRV1 MISSION shRNA shRNA Plasmid DNA
aspartic peptidase, retroviral-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-215s1c1
Sequence:CCGGCACAGAAATTAGCCTGGGCAACTCGAGTTGCCCAGGCTAATTTCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-137s1c1
Sequence:CCGGCCTGGATACTCTTCGTCCTTTCTCGAGAAAGGACGAAGAGTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-271s1c1
Sequence:CCGGCCAGCGCAGAAGAGGCTATTACTCGAGTAATAGCCTCTTCTGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-411s1c1
Sequence:CCGGGACCTGGAGCTTATTGAGGAACTCGAGTTCCTCAATAAGCTCCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-281s1c1
Sequence:CCGGAGAGGCTATTATTGGCACAGACTCGAGTCTGTGCCAATAATAGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026414
ASPRV1 MISSION shRNA Lentiviral Transduction Particles
aspartic peptidase, retroviral-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-215s1c1
Sequence:CCGGCACAGAAATTAGCCTGGGCAACTCGAGTTGCCCAGGCTAATTTCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-137s1c1
Sequence:CCGGCCTGGATACTCTTCGTCCTTTCTCGAGAAAGGACGAAGAGTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-271s1c1
Sequence:CCGGCCAGCGCAGAAGAGGCTATTACTCGAGTAATAGCCTCTTCTGCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-411s1c1
Sequence:CCGGGACCTGGAGCTTATTGAGGAACTCGAGTTCCTCAATAAGCTCCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026414.1-281s1c1
Sequence:CCGGAGAGGCTATTATTGGCACAGACTCGAGTCTGTGCCAATAATAGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks