EMAIL THIS PAGE TO A FRIEND

ASRGL1

asparaginase like 1

94 Gene Product Result for
Synonyms: ALP ALP1 CRASH
UniProtKB ID: Q7L266, B2R7Q0, Q567Q4, Q6P1P0, Q8NI34, Q9H6F7
Gene ID:
Mouse(66514) asparaginase like 1
Rat(246307) asparaginase like 1
sheep(100135685) asparaginase like 1
naked mole-rat(101713972) asparaginase like 1
domestic guinea pig(100713636) asparaginase like 1
Zebrafish(541402) asparaginase like 1
chicken(421868) asparaginase like 1
cow(767970) asparaginase like 1
domestic cat(101087268) asparaginase like 1
dog(483789) asparaginase like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408010 Anti-ASRGL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA055572 Anti-ASRGL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA029725 Anti-ASRGL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1408694 Anti-ASRGL1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107045 Anti-ASRGL1 antibody produced in rabbit affinity isolated antibody mouse, horse, rabbit, human, guinea pig
ELISA, western blot pricing
SAB2500128 Anti-ASRGL1/ALP antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
WH0080150M3 Monoclonal Anti-ASRGL1 antibody produced in mouse clone 5C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405282 Monoclonal Anti-ASRGL1 antibody produced in mouse clone 5C8, ascites fluid human
ELISA, western blot pricing
AMAB90907 Monoclonal Anti-ASRGL1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1679, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083926 Rosetta Predictions human pricing
NM_025080 Rosetta Predictions human pricing
NM_145089 Rosetta Predictions rat pricing
NM_025610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317321 predicted 646
2 SASI_Hs02_00317322 predicted 1222
3 SASI_Hs02_00317323 predicted 643
4 SASI_Hs02_00317324 predicted 870
5 SASI_Hs02_00317325 predicted 1054
6 SASI_Hs02_00317326 predicted 1047
7 SASI_Hs02_00317327 predicted 875
8 SASI_Hs02_00317328 predicted 570
9 SASI_Hs02_00317329 predicted 1180
10 SASI_Hs02_00317330 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102385 predicted 563
2 SASI_Hs02_00357764 predicted 1137
3 SASI_Hs01_00102386 predicted 571
4 SASI_Hs01_00102387 predicted 791
5 SASI_Hs01_00102388 predicted 983
6 SASI_Hs01_00102389 predicted 971
7 SASI_Hs01_00102392 predicted 799
8 SASI_Hs01_00102391 predicted 487
9 SASI_Hs02_00357765 predicted 1097
10 SASI_Hs02_00357766 predicted 1019
11 SASI_Hs01_00102390 predicted 978
12 SASI_Hs01_00102393 predicted 285
13 SASI_Hs01_00102394 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268674 predicted 203
2 SASI_Rn02_00268675 predicted 577
3 SASI_Rn02_00268676 predicted 295
4 SASI_Rn02_00268677 predicted 318
5 SASI_Rn02_00268678 predicted 725
6 SASI_Rn02_00268679 predicted 699
7 SASI_Rn02_00268680 predicted 395
8 SASI_Rn02_00268681 predicted 344
9 SASI_Rn02_00268682 predicted 600
10 SASI_Rn02_00268683 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089803 predicted 229
2 SASI_Mm01_00089804 predicted 721
3 SASI_Mm01_00089805 predicted 591
4 SASI_Mm01_00089807 predicted 249
5 SASI_Mm02_00328644 predicted 241
6 SASI_Mm01_00089809 predicted 350
7 SASI_Mm02_00328645 predicted 252
8 SASI_Mm01_00089810 predicted 800
9 SASI_Mm02_00328646 predicted 361
10 SASI_Mm02_00328647 predicted 297
11 SASI_Mm01_00089801 predicted 1034
12 SASI_Mm01_00089802 predicted 533
13 SASI_Mm01_00089806 predicted 677
14 SASI_Mm01_00089808 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025080
VALIDATED
ASRGL1 MISSION shRNA Bacterial Glycerol Stock
asparaginase like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-1156s21c1
Sequence:CCGGGCAAGCTGCACTTCGGAATTGCTCGAGCAATTCCGAAGTGCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-999s21c1
Sequence:CCGGGAACAAGGAAAGACGGTAGAACTCGAGTTCTACCGTCTTTCCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-507s21c1
Sequence:CCGGGTTGAAATGGATGCTAGTATCCTCGAGGATACTAGCATCCATTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025080.3-1431s21c1
Sequence:CCGGAGCTGAGGTGAGCCATGATTACTCGAGTAATCATGGCTCACCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025080.3-1383s21c1
Sequence:CCGGTGAGAGAAATGCCCGTATTAGCTCGAGCTAATACGGGCATTTCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-836s1c1
Sequence:CCGGCGGACCTATCGTTGGGTTATACTCGAGTATAACCCAACGATAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-706s1c1
Sequence:CCGGGCTGGAGGTTATGCCGACAATCTCGAGATTGTCGGCATAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-394s1c1
Sequence:CCGGCCCATTAAACTTGCTCGGCTTCTCGAGAAGCCGAGCAAGTTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-994s1c1
Sequence:CCGGGATACTACTATCACCGACCTTCTCGAGAAGGTCGGTGATAGTAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025080.2-372s1c1
Sequence:CCGGCGCAGTCCAGTGTATAGCAAACTCGAGTTTGCTATACACTGGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025080
VALIDATED
ASRGL1 MISSION shRNA shRNA Plasmid DNA
asparaginase like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-1156s21c1
Sequence:CCGGGCAAGCTGCACTTCGGAATTGCTCGAGCAATTCCGAAGTGCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-999s21c1
Sequence:CCGGGAACAAGGAAAGACGGTAGAACTCGAGTTCTACCGTCTTTCCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-507s21c1
Sequence:CCGGGTTGAAATGGATGCTAGTATCCTCGAGGATACTAGCATCCATTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025080.3-1431s21c1
Sequence:CCGGAGCTGAGGTGAGCCATGATTACTCGAGTAATCATGGCTCACCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025080.3-1383s21c1
Sequence:CCGGTGAGAGAAATGCCCGTATTAGCTCGAGCTAATACGGGCATTTCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-836s1c1
Sequence:CCGGCGGACCTATCGTTGGGTTATACTCGAGTATAACCCAACGATAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-706s1c1
Sequence:CCGGGCTGGAGGTTATGCCGACAATCTCGAGATTGTCGGCATAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-394s1c1
Sequence:CCGGCCCATTAAACTTGCTCGGCTTCTCGAGAAGCCGAGCAAGTTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-994s1c1
Sequence:CCGGGATACTACTATCACCGACCTTCTCGAGAAGGTCGGTGATAGTAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025080.2-372s1c1
Sequence:CCGGCGCAGTCCAGTGTATAGCAAACTCGAGTTTGCTATACACTGGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025080
VALIDATED
ASRGL1 MISSION shRNA Lentiviral Transduction Particles
asparaginase like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-1156s21c1
Sequence:CCGGGCAAGCTGCACTTCGGAATTGCTCGAGCAATTCCGAAGTGCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-999s21c1
Sequence:CCGGGAACAAGGAAAGACGGTAGAACTCGAGTTCTACCGTCTTTCCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025080.3-507s21c1
Sequence:CCGGGTTGAAATGGATGCTAGTATCCTCGAGGATACTAGCATCCATTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025080.3-1431s21c1
Sequence:CCGGAGCTGAGGTGAGCCATGATTACTCGAGTAATCATGGCTCACCTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025080.3-1383s21c1
Sequence:CCGGTGAGAGAAATGCCCGTATTAGCTCGAGCTAATACGGGCATTTCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-836s1c1
Sequence:CCGGCGGACCTATCGTTGGGTTATACTCGAGTATAACCCAACGATAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-706s1c1
Sequence:CCGGGCTGGAGGTTATGCCGACAATCTCGAGATTGTCGGCATAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-394s1c1
Sequence:CCGGCCCATTAAACTTGCTCGGCTTCTCGAGAAGCCGAGCAAGTTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025080.2-994s1c1
Sequence:CCGGGATACTACTATCACCGACCTTCTCGAGAAGGTCGGTGATAGTAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025080.2-372s1c1
Sequence:CCGGCGCAGTCCAGTGTATAGCAAACTCGAGTTTGCTATACACTGGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025610
VALIDATED
ASRGL1 MISSION shRNA Bacterial Glycerol Stock
asparaginase like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025610.2-268s1c1
Sequence:CCGGCCTGAATGTAAACGGTGATATCTCGAGATATCACCGTTTACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-365s1c1
Sequence:CCGGCCCGTTAAACTTGCACGGCTTCTCGAGAAGCCGTGCAAGTTTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025610.2-677s1c1
Sequence:CCGGGCTGGAGGTTACGCAGATAATCTCGAGATTATCTGCGTAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-816s1c1
Sequence:CCGGCATTGGATTACATGAAGTCAACTCGAGTTGACTTCATGTAATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-239s1c1
Sequence:CCGGCCAGAGTTCAACGCAGGTTATCTCGAGATAACCTGCGTTGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025610
VALIDATED
ASRGL1 MISSION shRNA shRNA Plasmid DNA
asparaginase like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025610.2-268s1c1
Sequence:CCGGCCTGAATGTAAACGGTGATATCTCGAGATATCACCGTTTACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-365s1c1
Sequence:CCGGCCCGTTAAACTTGCACGGCTTCTCGAGAAGCCGTGCAAGTTTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025610.2-677s1c1
Sequence:CCGGGCTGGAGGTTACGCAGATAATCTCGAGATTATCTGCGTAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-816s1c1
Sequence:CCGGCATTGGATTACATGAAGTCAACTCGAGTTGACTTCATGTAATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-239s1c1
Sequence:CCGGCCAGAGTTCAACGCAGGTTATCTCGAGATAACCTGCGTTGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025610
VALIDATED
ASRGL1 MISSION shRNA Lentiviral Transduction Particles
asparaginase like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025610.2-268s1c1
Sequence:CCGGCCTGAATGTAAACGGTGATATCTCGAGATATCACCGTTTACATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-365s1c1
Sequence:CCGGCCCGTTAAACTTGCACGGCTTCTCGAGAAGCCGTGCAAGTTTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025610.2-677s1c1
Sequence:CCGGGCTGGAGGTTACGCAGATAATCTCGAGATTATCTGCGTAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-816s1c1
Sequence:CCGGCATTGGATTACATGAAGTCAACTCGAGTTGACTTCATGTAATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025610.2-239s1c1
Sequence:CCGGCCAGAGTTCAACGCAGGTTATCTCGAGATAACCTGCGTTGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks