EMAIL THIS PAGE TO A FRIEND

ASS1

argininosuccinate synthase 1

85 Gene Product Result for
Synonyms: ASS CTLN1
UniProtKB ID: P00966, Q6LDL2, Q86UZ0, Q96GT4
Gene ID:
Human(445) Summary: The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
Mouse(11898) argininosuccinate synthetase 1
Rat(25698) argininosuccinate synthase 1
naked mole-rat(101696499) argininosuccinate synthase 1
domestic guinea pig(100731844) argininosuccinate synthase 1
Goat(100860879) argininosuccinate synthase 1
sheep(101115012) argininosuccinate synthase 1
Zebrafish(447864) argininosuccinate synthetase 1
cow(280726) argininosuccinate synthase 1
Horse(100069776) argininosuccinate synthase 1
domestic cat(101097525) argininosuccinate synthase 1
dog(480693) argininosuccinate synthase 1
chicken(417185) argininosuccinate synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500102 Anti-Argininosuccinate Synthetase 1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
AV41366 Anti-ASS (AB1) antibody produced in rabbit IgG fraction of antiserum canine, human, bovine, mouse, horse, rat, guinea pig, zebrafish
immunohistochemistry, western blot pricing
AV41367 Anti-ASS (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, human, guinea pig, rabbit, canine, bovine, rat, horse, pig
immunohistochemistry, western blot pricing
SAB1307232 ANTI-ASS (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
A7235 Anti-ASS1 (191-205) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A7360 Anti-ASS1 (433-445) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA020896 Anti-ASS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry, western blot pricing
HPA020934 Anti-ASS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5300141 Monoclonal Anti-ASS1 antibody produced in mouse clone 2B10, purified immunoglobulin, buffered aqueous solution monkey, rat, human, mouse
ELISA, flow cytometry, immunofluorescence, western blot pricing
SAB5300142 Monoclonal Anti-ASS1 antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution human, monkey, mouse
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000050 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110301 MISSION® esiRNA esiRNA human ASS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000050 Rosetta Predictions human pricing
NM_054012 Rosetta Predictions human pricing
NM_013157 Rosetta Predictions rat pricing
NM_007494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034349 predicted 643
2 SASI_Hs01_00034350 predicted 818
3 SASI_Hs02_00301747 predicted 823
4 SASI_Hs02_00301748 predicted 1565
5 SASI_Hs01_00034352 predicted 1163
6 SASI_Hs01_00034353 predicted 592
7 SASI_Hs02_00301749 predicted 1085
8 SASI_Hs02_00301750 predicted 1586
9 SASI_Hs01_00034354 predicted 1513
10 SASI_Hs01_00034355 predicted 1095
11 SASI_Hs01_00034351 predicted 927
12 SASI_Hs01_00034356 predicted 431
13 SASI_Hs01_00034357 predicted 271
14 SASI_Hs01_00034358 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151332 predicted 579
2 SASI_Hs01_00151333 predicted 756
3 SASI_Hs02_00361923 predicted 763
4 SASI_Hs02_00361924 predicted 1503
5 SASI_Hs01_00151335 predicted 1092
6 SASI_Hs01_00151336 predicted 529
7 SASI_Hs02_00361925 predicted 1023
8 SASI_Hs02_00361926 predicted 1524
9 SASI_Hs01_00151337 predicted 1444
10 SASI_Hs01_00151338 predicted 1032
11 SASI_Hs01_00151334 predicted 974
12 SASI_Hs01_00151339 predicted 481
13 SASI_Hs01_00151340 predicted 311
14 SASI_Hs01_00151341 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089812 predicted 478
2 SASI_Rn01_00089813 predicted 1134
3 SASI_Rn02_00260969 predicted 541
4 SASI_Rn01_00089815 predicted 468
5 SASI_Rn01_00089817 predicted 255
6 SASI_Rn02_00260970 predicted 387
7 SASI_Rn01_00089818 predicted 377
8 SASI_Rn02_00260971 predicted 819
9 SASI_Rn02_00260972 predicted 746
10 SASI_Rn01_00089821 predicted 871
11 SASI_Rn01_00089814 predicted 327
12 SASI_Rn01_00089816 predicted 345
13 SASI_Rn01_00089819 predicted 523
14 SASI_Rn01_00089820 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153169 predicted 842
2 SASI_Mm01_00153170 predicted 607
3 SASI_Mm01_00153171 predicted 496
4 SASI_Mm01_00153172 predicted 622
5 SASI_Mm01_00153173 predicted 263
6 SASI_Mm01_00153174 predicted 999
7 SASI_Mm01_00153175 predicted 589
8 SASI_Mm01_00153177 predicted 220
9 SASI_Mm01_00153178 predicted 371
10 SASI_Mm02_00311765 predicted 333
11 SASI_Mm01_00153176 predicted 1261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000050
ASS1 MISSION shRNA Bacterial Glycerol Stock
argininosuccinate synthase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-938s1c1
Sequence:CCGGCCATCCTTTACCATGCTCATTCTCGAGAATGAGCATGGTAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-1264s1c1
Sequence:CCGGCTCAGGCTGAAGGAATATCATCTCGAGATGATATTCCTTCAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-193s1c1
Sequence:CCGGCAGAAGGAAGACTTCGAGGAACTCGAGTTCCTCGAAGTCTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-1054s1c1
Sequence:CCGGCCTAGCCCTGAGTGTGAATTTCTCGAGAAATTCACACTCAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-516s1c1
Sequence:CCGGGCCTGAATTCTACAACCGGTTCTCGAGAACCGGTTGTAGAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000050.4-844s21c1
Sequence:CCGGACGCAAAGCAACACGGGATTCCTCGAGGAATCCCGTGTTGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000050.4-1641s21c1
Sequence:CCGGCCCAAGTACAGGCGCTAATTGCTCGAGCAATTAGCGCCTGTACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000050.4-1485s21c1
Sequence:CCGGATGAACGTGCAGGGTGATTATCTCGAGATAATCACCCTGCACGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000050
ASS1 MISSION shRNA shRNA Plasmid DNA
argininosuccinate synthase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-938s1c1
Sequence:CCGGCCATCCTTTACCATGCTCATTCTCGAGAATGAGCATGGTAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-1264s1c1
Sequence:CCGGCTCAGGCTGAAGGAATATCATCTCGAGATGATATTCCTTCAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-193s1c1
Sequence:CCGGCAGAAGGAAGACTTCGAGGAACTCGAGTTCCTCGAAGTCTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-1054s1c1
Sequence:CCGGCCTAGCCCTGAGTGTGAATTTCTCGAGAAATTCACACTCAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-516s1c1
Sequence:CCGGGCCTGAATTCTACAACCGGTTCTCGAGAACCGGTTGTAGAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000050.4-844s21c1
Sequence:CCGGACGCAAAGCAACACGGGATTCCTCGAGGAATCCCGTGTTGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000050.4-1641s21c1
Sequence:CCGGCCCAAGTACAGGCGCTAATTGCTCGAGCAATTAGCGCCTGTACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000050.4-1485s21c1
Sequence:CCGGATGAACGTGCAGGGTGATTATCTCGAGATAATCACCCTGCACGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000050
ASS1 MISSION shRNA Lentiviral Transduction Particles
argininosuccinate synthase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-938s1c1
Sequence:CCGGCCATCCTTTACCATGCTCATTCTCGAGAATGAGCATGGTAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-1264s1c1
Sequence:CCGGCTCAGGCTGAAGGAATATCATCTCGAGATGATATTCCTTCAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-193s1c1
Sequence:CCGGCAGAAGGAAGACTTCGAGGAACTCGAGTTCCTCGAAGTCTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-1054s1c1
Sequence:CCGGCCTAGCCCTGAGTGTGAATTTCTCGAGAAATTCACACTCAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000050.2-516s1c1
Sequence:CCGGGCCTGAATTCTACAACCGGTTCTCGAGAACCGGTTGTAGAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000050.4-844s21c1
Sequence:CCGGACGCAAAGCAACACGGGATTCCTCGAGGAATCCCGTGTTGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000050.4-1641s21c1
Sequence:CCGGCCCAAGTACAGGCGCTAATTGCTCGAGCAATTAGCGCCTGTACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000050.4-1485s21c1
Sequence:CCGGATGAACGTGCAGGGTGATTATCTCGAGATAATCACCCTGCACGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007494
VALIDATED
ASS1 MISSION shRNA Bacterial Glycerol Stock
argininosuccinate synthase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007494.2-1418s1c1
Sequence:CCGGCTCCCAGGCTTCAGCATTAATCTCGAGATTAATGCTGAAGCCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-1231s1c1
Sequence:CCGGGTCTCCACTTTCACTCTACAACTCGAGTTGTAGAGTGAAAGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-617s1c1
Sequence:CCGGCTGATGGAGTATGCAAAGCAACTCGAGTTGCTTTGCATACTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007494.2-206s1c1
Sequence:CCGGTGGCTGAAGGAACAAGGCTATCTCGAGATAGCCTTGTTCCTTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-1131s1c1
Sequence:CCGGGTGAATTTGTTCGCCACTGTACTCGAGTACAGTGGCGAACAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-520s21c1
Sequence:CCGGCTTTGAGCTCACCTGCTATTCCTCGAGGAATAGCAGGTGAGCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-1003s21c1
Sequence:CCGGCATCCTTTACCACGCTCATTTCTCGAGAAATGAGCGTGGTAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007494.3-1450s21c1
Sequence:CCGGATTTGTAATTGTAGCTTGTTCCTCGAGGAACAAGCTACAATTACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-1357s21c1
Sequence:CCGGGAGCAAGGTCACTGCCAAATACTCGAGTATTTGGCAGTGACCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007494
VALIDATED
ASS1 MISSION shRNA shRNA Plasmid DNA
argininosuccinate synthase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007494.2-1418s1c1
Sequence:CCGGCTCCCAGGCTTCAGCATTAATCTCGAGATTAATGCTGAAGCCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-1231s1c1
Sequence:CCGGGTCTCCACTTTCACTCTACAACTCGAGTTGTAGAGTGAAAGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-617s1c1
Sequence:CCGGCTGATGGAGTATGCAAAGCAACTCGAGTTGCTTTGCATACTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007494.2-206s1c1
Sequence:CCGGTGGCTGAAGGAACAAGGCTATCTCGAGATAGCCTTGTTCCTTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-1131s1c1
Sequence:CCGGGTGAATTTGTTCGCCACTGTACTCGAGTACAGTGGCGAACAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-520s21c1
Sequence:CCGGCTTTGAGCTCACCTGCTATTCCTCGAGGAATAGCAGGTGAGCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-1003s21c1
Sequence:CCGGCATCCTTTACCACGCTCATTTCTCGAGAAATGAGCGTGGTAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007494.3-1450s21c1
Sequence:CCGGATTTGTAATTGTAGCTTGTTCCTCGAGGAACAAGCTACAATTACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-1357s21c1
Sequence:CCGGGAGCAAGGTCACTGCCAAATACTCGAGTATTTGGCAGTGACCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007494
VALIDATED
ASS1 MISSION shRNA Lentiviral Transduction Particles
argininosuccinate synthase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007494.2-1418s1c1
Sequence:CCGGCTCCCAGGCTTCAGCATTAATCTCGAGATTAATGCTGAAGCCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-1231s1c1
Sequence:CCGGGTCTCCACTTTCACTCTACAACTCGAGTTGTAGAGTGAAAGTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-617s1c1
Sequence:CCGGCTGATGGAGTATGCAAAGCAACTCGAGTTGCTTTGCATACTCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007494.2-206s1c1
Sequence:CCGGTGGCTGAAGGAACAAGGCTATCTCGAGATAGCCTTGTTCCTTCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007494.2-1131s1c1
Sequence:CCGGGTGAATTTGTTCGCCACTGTACTCGAGTACAGTGGCGAACAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-520s21c1
Sequence:CCGGCTTTGAGCTCACCTGCTATTCCTCGAGGAATAGCAGGTGAGCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-1003s21c1
Sequence:CCGGCATCCTTTACCACGCTCATTTCTCGAGAAATGAGCGTGGTAAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007494.3-1450s21c1
Sequence:CCGGATTTGTAATTGTAGCTTGTTCCTCGAGGAACAAGCTACAATTACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007494.3-1357s21c1
Sequence:CCGGGAGCAAGGTCACTGCCAAATACTCGAGTATTTGGCAGTGACCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks