EMAIL THIS PAGE TO A FRIEND

ASTE1

asteroid homolog 1 (Drosophila)

70 Gene Product Result for
UniProtKB ID: Q2TB18, Q3MIB6, Q8N6G4, Q96JY1, Q9UHX6
Gene ID:
Mouse(66595) asteroid homolog 1 (Drosophila)
Rat(363130) asteroid homolog 1 (Drosophila)
Zebrafish(100006826) asteroid homolog 1 (Drosophila)
chicken(420684) asteroid homolog 1 (Drosophila)
dog(610708) asteroid homolog 1 (Drosophila)
Horse(100064548) asteroid homolog 1 (Drosophila)
cow(101905341) asteroid homolog 1 (Drosophila)
cow(510558) asteroid homolog 1 (Drosophila)
domestic cat(101091393) asteroid homolog 1 (Drosophila)
sheep(101117135) asteroid homolog 1 (Drosophila)
Domestic Rabbit(100354702) asteroid homolog 1 (Drosophila)
domestic guinea pig(100717863) asteroid homolog 1 (Drosophila)
naked mole-rat(101707490) asteroid homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029391 MISSION® esiRNA esiRNA human ASTE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014065 Rosetta Predictions human pricing
NM_001040156 Rosetta Predictions rat pricing
XM_001072964 Rosetta Predictions rat pricing
XM_001081962 Rosetta Predictions rat pricing
NM_025651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206842 predicted 862
2 SASI_Hs01_00206843 predicted 1451
3 SASI_Hs01_00206844 predicted 1376
4 SASI_Hs01_00206845 predicted 696
5 SASI_Hs01_00206846 predicted 794
6 SASI_Hs01_00206847 predicted 1554
7 SASI_Hs01_00206848 predicted 1216
8 SASI_Hs01_00206849 predicted 496
9 SASI_Hs01_00206850 predicted 1462
10 SASI_Hs01_00206851 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054421 predicted 1233
2 SASI_Rn01_00054422 predicted 993
3 SASI_Rn01_00054423 predicted 459
4 SASI_Rn01_00054424 predicted 1147
5 SASI_Rn01_00054425 predicted 1112
6 SASI_Rn01_00054427 predicted 1108
7 SASI_Rn01_00054428 predicted 1196
8 SASI_Rn02_00204905 predicted 439
9 SASI_Rn01_00054430 predicted 1258
10 SASI_Rn02_00204906 predicted 902
11 SASI_Rn01_00054426 predicted 1065
12 SASI_Rn01_00054429 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341148 predicted 807
2 SASI_Rn02_00341149 predicted 427
3 SASI_Rn02_00341150 predicted 553
4 SASI_Rn02_00341151 predicted 1078
5 SASI_Rn02_00341152 predicted 552
6 SASI_Rn02_00341153 predicted 1155
7 SASI_Rn02_00341154 predicted 955
8 SASI_Rn02_00341155 predicted 816
9 SASI_Rn02_00341156 predicted 450
10 SASI_Rn02_00341157 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374271 predicted 269
2 SASI_Rn02_00374272 predicted 304
3 SASI_Rn02_00374273 predicted 373
4 SASI_Rn02_00374274 predicted 375
5 SASI_Rn02_00374275 predicted 488
6 SASI_Rn02_00374276 predicted 366
7 SASI_Rn02_00374277 predicted 272
8 SASI_Rn02_00374278 predicted 348
9 SASI_Rn02_00374279 predicted 348
10 SASI_Rn02_00374280 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096090 predicted 970
2 SASI_Mm01_00096091 predicted 1367
3 SASI_Mm02_00328767 predicted 1667
4 SASI_Mm01_00096092 predicted 587
5 SASI_Mm01_00096093 predicted 1396
6 SASI_Mm01_00096094 predicted 607
7 SASI_Mm01_00096095 predicted 710
8 SASI_Mm01_00096096 predicted 1077
9 SASI_Mm01_00096097 predicted 366
10 SASI_Mm01_00096098 predicted 1424
11 SASI_Mm01_00096099 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014065
ASTE1 MISSION shRNA Bacterial Glycerol Stock
asteroid homolog 1 (Drosophila)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014065.2-2491s21c1
Sequence:CCGGTTGCATCAAACTAGATGTATTCTCGAGAATACATCTAGTTTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-2457s1c1
Sequence:CCGGATAGTGAGGCCTCCAACATTGCTCGAGCAATGTTGGAGGCCTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-858s1c1
Sequence:CCGGCAGAAGCAGATCGGGACATTACTCGAGTAATGTCCCGATCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-858s21c1
Sequence:CCGGCAGAAGCAGATCGGGACATTACTCGAGTAATGTCCCGATCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-1554s21c1
Sequence:CCGGCCATCAGGCAAATCATCTATGCTCGAGCATAGATGATTTGCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-2457s21c1
Sequence:CCGGATAGTGAGGCCTCCAACATTGCTCGAGCAATGTTGGAGGCCTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-647s21c1
Sequence:CCGGGCTTGTAATATATGCCCATATCTCGAGATATGGGCATATATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1927s1c1
Sequence:CCGGGCCCTTGATTGCCATAATCAACTCGAGTTGATTATGGCAATCAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1709s1c1
Sequence:CCGGGCCAAGGATCATTCTGACTTACTCGAGTAAGTCAGAATGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1710s1c1
Sequence:CCGGCCAAGGATCATTCTGACTTAACTCGAGTTAAGTCAGAATGATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-1397s1c1
Sequence:CCGGGATGCCTTGAATCTTGGTTTACTCGAGTAAACCAAGATTCAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014065.2-2489s1c1
Sequence:CCGGGTTTGCATCAAACTAGATGTACTCGAGTACATCTAGTTTGATGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-1117s1c1
Sequence:CCGGCCATGTTAATCTACCCATCATCTCGAGATGATGGGTAGATTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-2416s1c1
Sequence:CCGGCAACCGGTTTGGGTTGTTAATCTCGAGATTAACAACCCAAACCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-2420s1c1
Sequence:CCGGCGGTTTGGGTTGTTAATGGTTCTCGAGAACCATTAACAACCCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014065
ASTE1 MISSION shRNA shRNA Plasmid DNA
asteroid homolog 1 (Drosophila)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014065.2-2491s21c1
Sequence:CCGGTTGCATCAAACTAGATGTATTCTCGAGAATACATCTAGTTTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-2457s1c1
Sequence:CCGGATAGTGAGGCCTCCAACATTGCTCGAGCAATGTTGGAGGCCTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-858s1c1
Sequence:CCGGCAGAAGCAGATCGGGACATTACTCGAGTAATGTCCCGATCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-858s21c1
Sequence:CCGGCAGAAGCAGATCGGGACATTACTCGAGTAATGTCCCGATCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-1554s21c1
Sequence:CCGGCCATCAGGCAAATCATCTATGCTCGAGCATAGATGATTTGCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-2457s21c1
Sequence:CCGGATAGTGAGGCCTCCAACATTGCTCGAGCAATGTTGGAGGCCTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-647s21c1
Sequence:CCGGGCTTGTAATATATGCCCATATCTCGAGATATGGGCATATATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1927s1c1
Sequence:CCGGGCCCTTGATTGCCATAATCAACTCGAGTTGATTATGGCAATCAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1709s1c1
Sequence:CCGGGCCAAGGATCATTCTGACTTACTCGAGTAAGTCAGAATGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1710s1c1
Sequence:CCGGCCAAGGATCATTCTGACTTAACTCGAGTTAAGTCAGAATGATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-1397s1c1
Sequence:CCGGGATGCCTTGAATCTTGGTTTACTCGAGTAAACCAAGATTCAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014065.2-2489s1c1
Sequence:CCGGGTTTGCATCAAACTAGATGTACTCGAGTACATCTAGTTTGATGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-1117s1c1
Sequence:CCGGCCATGTTAATCTACCCATCATCTCGAGATGATGGGTAGATTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-2416s1c1
Sequence:CCGGCAACCGGTTTGGGTTGTTAATCTCGAGATTAACAACCCAAACCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-2420s1c1
Sequence:CCGGCGGTTTGGGTTGTTAATGGTTCTCGAGAACCATTAACAACCCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014065
ASTE1 MISSION shRNA Lentiviral Transduction Particles
asteroid homolog 1 (Drosophila)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014065.2-2491s21c1
Sequence:CCGGTTGCATCAAACTAGATGTATTCTCGAGAATACATCTAGTTTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-2457s1c1
Sequence:CCGGATAGTGAGGCCTCCAACATTGCTCGAGCAATGTTGGAGGCCTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-858s1c1
Sequence:CCGGCAGAAGCAGATCGGGACATTACTCGAGTAATGTCCCGATCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-858s21c1
Sequence:CCGGCAGAAGCAGATCGGGACATTACTCGAGTAATGTCCCGATCTGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-1554s21c1
Sequence:CCGGCCATCAGGCAAATCATCTATGCTCGAGCATAGATGATTTGCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-2457s21c1
Sequence:CCGGATAGTGAGGCCTCCAACATTGCTCGAGCAATGTTGGAGGCCTCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014065.2-647s21c1
Sequence:CCGGGCTTGTAATATATGCCCATATCTCGAGATATGGGCATATATTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1927s1c1
Sequence:CCGGGCCCTTGATTGCCATAATCAACTCGAGTTGATTATGGCAATCAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1709s1c1
Sequence:CCGGGCCAAGGATCATTCTGACTTACTCGAGTAAGTCAGAATGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014065.2-1710s1c1
Sequence:CCGGCCAAGGATCATTCTGACTTAACTCGAGTTAAGTCAGAATGATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-1397s1c1
Sequence:CCGGGATGCCTTGAATCTTGGTTTACTCGAGTAAACCAAGATTCAAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014065.2-2489s1c1
Sequence:CCGGGTTTGCATCAAACTAGATGTACTCGAGTACATCTAGTTTGATGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-1117s1c1
Sequence:CCGGCCATGTTAATCTACCCATCATCTCGAGATGATGGGTAGATTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-2416s1c1
Sequence:CCGGCAACCGGTTTGGGTTGTTAATCTCGAGATTAACAACCCAAACCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014065.2-2420s1c1
Sequence:CCGGCGGTTTGGGTTGTTAATGGTTCTCGAGAACCATTAACAACCCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025651
ASTE1 MISSION shRNA Bacterial Glycerol Stock
asteroid homolog 1 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-368s1c1
Sequence:CCGGGTGTGTCATATTTGTCCGTATCTCGAGATACGGACAAATATGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-1949s1c1
Sequence:CCGGCCTGAGGCAAAGCAACTTTATCTCGAGATAAAGTTGCTTTGCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-383s1c1
Sequence:CCGGCCGTATGTTGTATTAGATGGACTCGAGTCCATCTAATACAACATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-1315s1c1
Sequence:CCGGCGCAGAAGATATAGCCCAGAACTCGAGTTCTGGGCTATATCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025651
ASTE1 MISSION shRNA shRNA Plasmid DNA
asteroid homolog 1 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-368s1c1
Sequence:CCGGGTGTGTCATATTTGTCCGTATCTCGAGATACGGACAAATATGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-1949s1c1
Sequence:CCGGCCTGAGGCAAAGCAACTTTATCTCGAGATAAAGTTGCTTTGCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-383s1c1
Sequence:CCGGCCGTATGTTGTATTAGATGGACTCGAGTCCATCTAATACAACATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-1315s1c1
Sequence:CCGGCGCAGAAGATATAGCCCAGAACTCGAGTTCTGGGCTATATCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025651
ASTE1 MISSION shRNA Lentiviral Transduction Particles
asteroid homolog 1 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-368s1c1
Sequence:CCGGGTGTGTCATATTTGTCCGTATCTCGAGATACGGACAAATATGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-1949s1c1
Sequence:CCGGCCTGAGGCAAAGCAACTTTATCTCGAGATAAAGTTGCTTTGCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-383s1c1
Sequence:CCGGCCGTATGTTGTATTAGATGGACTCGAGTCCATCTAATACAACATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025651.2-1315s1c1
Sequence:CCGGCGCAGAAGATATAGCCCAGAACTCGAGTTCTGGGCTATATCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks