EMAIL THIS PAGE TO A FRIEND

ASTL

astacin-like metallo-endopeptidase (M12 family)

47 Gene Product Result for
UniProtKB ID: Q6HA08, Q3KNT0
Gene ID:
Mouse(215095) astacin-like metalloendopeptidase (M12 family)
Rat(296129) astacin-like metalloendopeptidase (M12 family)
chicken(423176) astacin-like metallo-endopeptidase (M12 family)
dog(483052) astacin-like metallo-endopeptidase (M12 family)
cow(511079) astacin-like metallo-endopeptidase (M12 family)
Horse(100062491) astacin-like metallo-endopeptidase (M12 family)
domestic cat(101092598) astacin-like metallo-endopeptidase (M12 family)
naked mole-rat(101717278) astacin-like metallo-endopeptidase (M12 family)
domestic guinea pig(100716830) astacin-like metallo-endopeptidase (M12 family)
sheep(101115954) astacin-like metallo-endopeptidase (M12 family)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015620 Anti-ASTL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002036 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016041 MISSION® esiRNA esiRNA targeting human ASTL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002036 Rosetta Predictions human pricing
NM_001106504 Rosetta Predictions rat pricing
NM_172539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132028 predicted 804
2 SASI_Hs01_00132029 predicted 595
3 SASI_Hs01_00132030 predicted 602
4 SASI_Hs01_00132031 predicted 798
5 SASI_Hs01_00132032 predicted 679
6 SASI_Hs01_00132033 predicted 195
7 SASI_Hs01_00132034 predicted 402
8 SASI_Hs02_00304108 predicted 661
9 SASI_Hs02_00304109 predicted 631
10 SASI_Hs02_00304110 predicted 908
11 SASI_Hs01_00132035 predicted 875
12 SASI_Hs01_00132036 predicted 829
13 SASI_Hs01_00132037 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219618 predicted 299
2 SASI_Rn02_00219619 predicted 433
3 SASI_Rn02_00219620 predicted 1261
4 SASI_Rn02_00219621 predicted 704
5 SASI_Rn02_00219622 predicted 754
6 SASI_Rn02_00219623 predicted 714
7 SASI_Rn02_00219624 predicted 960
8 SASI_Rn02_00219625 predicted 1049
9 SASI_Rn02_00219626 predicted 212
10 SASI_Rn02_00219627 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057327 predicted 1188
2 SASI_Mm01_00057329 predicted 877
3 SASI_Mm01_00057330 predicted 527
4 SASI_Mm01_00057331 predicted 1397
5 SASI_Mm01_00057332 predicted 568
6 SASI_Mm02_00344149 predicted 893
7 SASI_Mm01_00057334 predicted 797
8 SASI_Mm01_00057335 predicted 561
9 SASI_Mm01_00057336 predicted 857
10 SASI_Mm02_00344150 predicted 352
11 SASI_Mm01_00057328 predicted 989
12 SASI_Mm01_00057333 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172539
ASTL MISSION shRNA Bacterial Glycerol Stock
astacin-like metallo-endopeptidase (M12 family)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1106s1c1
Sequence:CCGGCCTCTATATCACGTCTACAAACTCGAGTTTGTAGACGTGATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1367s1c1
Sequence:CCGGCCACTGTACCTCTTGCTCTATCTCGAGATAGAGCAAGAGGTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1411s1c1
Sequence:CCGGGCACCTATCCAAGATGCCTTTCTCGAGAAAGGCATCTTGGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-801s1c1
Sequence:CCGGCCAAGTCAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-544s1c1
Sequence:CCGGCGGGTCATTATGGATGCCTTTCTCGAGAAAGGCATCCATAATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172539
ASTL MISSION shRNA shRNA Plasmid DNA
astacin-like metallo-endopeptidase (M12 family)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1106s1c1
Sequence:CCGGCCTCTATATCACGTCTACAAACTCGAGTTTGTAGACGTGATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1367s1c1
Sequence:CCGGCCACTGTACCTCTTGCTCTATCTCGAGATAGAGCAAGAGGTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1411s1c1
Sequence:CCGGGCACCTATCCAAGATGCCTTTCTCGAGAAAGGCATCTTGGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-801s1c1
Sequence:CCGGCCAAGTCAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-544s1c1
Sequence:CCGGCGGGTCATTATGGATGCCTTTCTCGAGAAAGGCATCCATAATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172539
ASTL MISSION shRNA Lentiviral Transduction Particles
astacin-like metallo-endopeptidase (M12 family)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1106s1c1
Sequence:CCGGCCTCTATATCACGTCTACAAACTCGAGTTTGTAGACGTGATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1367s1c1
Sequence:CCGGCCACTGTACCTCTTGCTCTATCTCGAGATAGAGCAAGAGGTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-1411s1c1
Sequence:CCGGGCACCTATCCAAGATGCCTTTCTCGAGAAAGGCATCTTGGATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-801s1c1
Sequence:CCGGCCAAGTCAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172539.1-544s1c1
Sequence:CCGGCGGGTCATTATGGATGCCTTTCTCGAGAAAGGCATCCATAATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002036
ASTL MISSION shRNA Bacterial Glycerol Stock
astacin-like metallo-endopeptidase (M12 family)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-633s1c1
Sequence:CCGGGCCAGGCTTTGAAATCAACTTCTCGAGAAGTTGATTTCAAAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-687s1c1
Sequence:CCGGCTATGACTACTCCTCTGTGATCTCGAGATCACAGAGGAGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-42s1c1
Sequence:CCGGGCTCTCCTTGCCAGGTGTGATCTCGAGATCACACCTGGCAAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-155s1c1
Sequence:CCGGACAAGGACATTCCTGCAATTACTCGAGTAATTGCAGGAATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-394s1c1
Sequence:CCGGTGCATCAGGTTTGTCACCTATCTCGAGATAGGTGACAAACCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002036
ASTL MISSION shRNA shRNA Plasmid DNA
astacin-like metallo-endopeptidase (M12 family)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-633s1c1
Sequence:CCGGGCCAGGCTTTGAAATCAACTTCTCGAGAAGTTGATTTCAAAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-687s1c1
Sequence:CCGGCTATGACTACTCCTCTGTGATCTCGAGATCACAGAGGAGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-42s1c1
Sequence:CCGGGCTCTCCTTGCCAGGTGTGATCTCGAGATCACACCTGGCAAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-155s1c1
Sequence:CCGGACAAGGACATTCCTGCAATTACTCGAGTAATTGCAGGAATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-394s1c1
Sequence:CCGGTGCATCAGGTTTGTCACCTATCTCGAGATAGGTGACAAACCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002036
ASTL MISSION shRNA Lentiviral Transduction Particles
astacin-like metallo-endopeptidase (M12 family)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-633s1c1
Sequence:CCGGGCCAGGCTTTGAAATCAACTTCTCGAGAAGTTGATTTCAAAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-687s1c1
Sequence:CCGGCTATGACTACTCCTCTGTGATCTCGAGATCACAGAGGAGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-42s1c1
Sequence:CCGGGCTCTCCTTGCCAGGTGTGATCTCGAGATCACACCTGGCAAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-155s1c1
Sequence:CCGGACAAGGACATTCCTGCAATTACTCGAGTAATTGCAGGAATGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002036.2-394s1c1
Sequence:CCGGTGCATCAGGTTTGTCACCTATCTCGAGATAGGTGACAAACCTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks