EMAIL THIS PAGE TO A FRIEND

ASTN1

astrotactin 1

148 Gene Product Result for
Synonyms: ASTN
Gene ID:
Human(460) Summary: Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
Mouse(11899) astrotactin 1
Rat(304900) astrotactin 1
sheep(101118463) astrotactin 1
Zebrafish(791157) astrotactin 1
chicken(429070) astrotactin 1
domestic cat(101098600) astrotactin 1
cow(536162) astrotactin 1
Horse(100062059) astrotactin 1
dog(490331) astrotactin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004319 Rosetta Predictions human pricing
NM_207108 Rosetta Predictions human pricing
XM_001068638 Rosetta Predictions rat pricing
XM_001068691 Rosetta Predictions rat pricing
XM_222785 Rosetta Predictions rat pricing
NM_007495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180647 predicted 2925
2 SASI_Hs01_00180648 predicted 1954
3 SASI_Hs01_00180651 predicted 1089
4 SASI_Hs02_00337356 predicted 808
5 SASI_Hs01_00180652 predicted 2852
6 SASI_Hs01_00180653 predicted 548
7 SASI_Hs01_00180654 predicted 2811
8 SASI_Hs01_00180655 predicted 498
9 SASI_Hs02_00337357 predicted 3446
10 SASI_Hs01_00180656 predicted 2793
11 SASI_Hs01_00180649 predicted 934
12 SASI_Hs01_00180650 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022824 predicted 2932
2 SASI_Hs01_00022825 predicted 1954
3 SASI_Hs01_00022828 predicted 1095
4 SASI_Hs02_00373742 predicted 804
5 SASI_Hs01_00022829 predicted 2851
6 SASI_Hs01_00022830 predicted 549
7 SASI_Hs01_00022831 predicted 2810
8 SASI_Hs01_00022832 predicted 504
9 SASI_Hs02_00373743 predicted 3443
10 SASI_Hs01_00022833 predicted 2791
11 SASI_Hs01_00022826 predicted 932
12 SASI_Hs01_00022827 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325256 predicted 1349
2 SASI_Rn02_00325257 predicted 3258
3 SASI_Rn02_00325258 predicted 3331
4 SASI_Rn02_00325259 predicted 2692
5 SASI_Rn02_00325260 predicted 1481
6 SASI_Rn02_00325261 predicted 995
7 SASI_Rn02_00325262 predicted 1731
8 SASI_Rn02_00325263 predicted 2090
9 SASI_Rn02_00325264 predicted 1700
10 SASI_Rn02_00325265 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325479 predicted 905
2 SASI_Rn02_00325480 predicted 914
3 SASI_Rn02_00325481 predicted 4016
4 SASI_Rn02_00325482 predicted 4091
5 SASI_Rn02_00325483 predicted 789
6 SASI_Rn02_00325484 predicted 3455
7 SASI_Rn02_00325485 predicted 2236
8 SASI_Rn02_00325486 predicted 1759
9 SASI_Rn02_00325487 predicted 2491
10 SASI_Rn02_00325488 predicted 2854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380905 predicted 2122
2 SASI_Rn02_00380906 predicted 682
3 SASI_Rn02_00380907 predicted 4015
4 SASI_Rn02_00380908 predicted 4093
5 SASI_Rn02_00380909 predicted 783
6 SASI_Rn02_00380910 predicted 3458
7 SASI_Rn02_00380911 predicted 2240
8 SASI_Rn02_00380912 predicted 1766
9 SASI_Rn02_00380913 predicted 2493
10 SASI_Rn02_00380914 predicted 2853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085651 predicted 3866
2 SASI_Mm01_00085653 predicted 2103
3 SASI_Mm01_00085654 predicted 587
4 SASI_Mm02_00311766 predicted 2890
5 SASI_Mm01_00085655 predicted 2276
6 SASI_Mm01_00085656 predicted 1903
7 SASI_Mm01_00085657 predicted 1687
8 SASI_Mm01_00085658 predicted 2163
9 SASI_Mm02_00311767 predicted 717
10 SASI_Mm01_00085659 predicted 4020
11 SASI_Mm01_00085652 predicted 597
12 SASI_Mm01_00085660 predicted 1922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007495
ASTN1 MISSION shRNA Bacterial Glycerol Stock
astrotactin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007495.2-5514s1c1
Sequence:CCGGGCCTTATTCATACTTTCCAATCTCGAGATTGGAAAGTATGAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-2379s1c1
Sequence:CCGGCCCATGAACCAGACTCTCTTTCTCGAGAAAGAGAGTCTGGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-2027s1c1
Sequence:CCGGGCGTGATTGCAGCAAAGATAACTCGAGTTATCTTTGCTGCAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-1748s1c1
Sequence:CCGGGCCTTGGCCTTACACGATATTCTCGAGAATATCGTGTAAGGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-1205s1c1
Sequence:CCGGCCAGAGAAAGAGGATCAACAACTCGAGTTGTTGATCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007495
ASTN1 MISSION shRNA shRNA Plasmid DNA
astrotactin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007495.2-5514s1c1
Sequence:CCGGGCCTTATTCATACTTTCCAATCTCGAGATTGGAAAGTATGAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-2379s1c1
Sequence:CCGGCCCATGAACCAGACTCTCTTTCTCGAGAAAGAGAGTCTGGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-2027s1c1
Sequence:CCGGGCGTGATTGCAGCAAAGATAACTCGAGTTATCTTTGCTGCAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-1748s1c1
Sequence:CCGGGCCTTGGCCTTACACGATATTCTCGAGAATATCGTGTAAGGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-1205s1c1
Sequence:CCGGCCAGAGAAAGAGGATCAACAACTCGAGTTGTTGATCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007495
ASTN1 MISSION shRNA Lentiviral Transduction Particles
astrotactin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007495.2-5514s1c1
Sequence:CCGGGCCTTATTCATACTTTCCAATCTCGAGATTGGAAAGTATGAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-2379s1c1
Sequence:CCGGCCCATGAACCAGACTCTCTTTCTCGAGAAAGAGAGTCTGGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-2027s1c1
Sequence:CCGGGCGTGATTGCAGCAAAGATAACTCGAGTTATCTTTGCTGCAATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-1748s1c1
Sequence:CCGGGCCTTGGCCTTACACGATATTCTCGAGAATATCGTGTAAGGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007495.2-1205s1c1
Sequence:CCGGCCAGAGAAAGAGGATCAACAACTCGAGTTGTTGATCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004319
ASTN1 MISSION shRNA Bacterial Glycerol Stock
astrotactin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-1955s1c1
Sequence:CCGGGCTGATGACTTCATCCTCCTTCTCGAGAAGGAGGATGAAGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-6915s1c1
Sequence:CCGGCCGGTATTCAACCTTGAGTTTCTCGAGAAACTCAAGGTTGAATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-4320s1c1
Sequence:CCGGGCCATATTTCTTTAGAGGATTCTCGAGAATCCTCTAAAGAAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-804s1c1
Sequence:CCGGGCCAATGAGATTCACTACATTCTCGAGAATGTAGTGAATCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-2044s1c2
Sequence:CCGGGCAGTAAGAATTTCCGCTGTACTCGAGTACAGCGGAAATTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-4801s1c1
Sequence:CCGGCCTCTGAACAACATGATCTTTCTCGAGAAAGATCATGTTGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-1736s1c1
Sequence:CCGGGCCATGGCCTTACACAATATTCTCGAGAATATTGTGTAAGGCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-2057s1c1
Sequence:CCGGCCGCTGTATTTCAGATCGCAACTCGAGTTGCGATCTGAAATACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-3461s1c1
Sequence:CCGGCGACATCATCTCTGGAGCAAACTCGAGTTTGCTCCAGAGATGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004319
ASTN1 MISSION shRNA shRNA Plasmid DNA
astrotactin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-1955s1c1
Sequence:CCGGGCTGATGACTTCATCCTCCTTCTCGAGAAGGAGGATGAAGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-6915s1c1
Sequence:CCGGCCGGTATTCAACCTTGAGTTTCTCGAGAAACTCAAGGTTGAATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-4320s1c1
Sequence:CCGGGCCATATTTCTTTAGAGGATTCTCGAGAATCCTCTAAAGAAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-804s1c1
Sequence:CCGGGCCAATGAGATTCACTACATTCTCGAGAATGTAGTGAATCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-2044s1c2
Sequence:CCGGGCAGTAAGAATTTCCGCTGTACTCGAGTACAGCGGAAATTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-4801s1c1
Sequence:CCGGCCTCTGAACAACATGATCTTTCTCGAGAAAGATCATGTTGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-1736s1c1
Sequence:CCGGGCCATGGCCTTACACAATATTCTCGAGAATATTGTGTAAGGCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-2057s1c1
Sequence:CCGGCCGCTGTATTTCAGATCGCAACTCGAGTTGCGATCTGAAATACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-3461s1c1
Sequence:CCGGCGACATCATCTCTGGAGCAAACTCGAGTTTGCTCCAGAGATGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004319
ASTN1 MISSION shRNA Lentiviral Transduction Particles
astrotactin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-1955s1c1
Sequence:CCGGGCTGATGACTTCATCCTCCTTCTCGAGAAGGAGGATGAAGTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-6915s1c1
Sequence:CCGGCCGGTATTCAACCTTGAGTTTCTCGAGAAACTCAAGGTTGAATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-4320s1c1
Sequence:CCGGGCCATATTTCTTTAGAGGATTCTCGAGAATCCTCTAAAGAAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-804s1c1
Sequence:CCGGGCCAATGAGATTCACTACATTCTCGAGAATGTAGTGAATCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-2044s1c2
Sequence:CCGGGCAGTAAGAATTTCCGCTGTACTCGAGTACAGCGGAAATTCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004319.1-4801s1c1
Sequence:CCGGCCTCTGAACAACATGATCTTTCTCGAGAAAGATCATGTTGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-1736s1c1
Sequence:CCGGGCCATGGCCTTACACAATATTCTCGAGAATATTGTGTAAGGCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-2057s1c1
Sequence:CCGGCCGCTGTATTTCAGATCGCAACTCGAGTTGCGATCTGAAATACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004319.1-3461s1c1
Sequence:CCGGCGACATCATCTCTGGAGCAAACTCGAGTTTGCTCCAGAGATGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks