EMAIL THIS PAGE TO A FRIEND

ASTN2

astrotactin 2

Synonyms: bA67K19.1
Gene ID:
Human(23245) Summary: This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Mouse(56079) astrotactin 2
Rat(100361323) astrotactin 2
chicken(417242) astrotactin 2
cow(781555) astrotactin 2
dog(481693) astrotactin 2
domestic cat(101084834) astrotactin 2
sheep(101123440) astrotactin 2
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069541 MISSION® esiRNA esiRNA human ASTN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014010 Rosetta Predictions human pricing
NM_198186 Rosetta Predictions human pricing
NM_198187 Rosetta Predictions human pricing
NM_198188 Rosetta Predictions human pricing
NM_019514 Rosetta Predictions mouse pricing
NM_207109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082285 predicted 3240
2 SASI_Hs02_00344981 predicted 3235
3 SASI_Hs01_00082286 predicted 3432
4 SASI_Hs01_00082287 predicted 3257
5 SASI_Hs01_00082288 predicted 3340
6 SASI_Hs01_00082289 predicted 3088
7 SASI_Hs01_00082290 predicted 3366
8 SASI_Hs01_00082291 predicted 3410
9 SASI_Hs01_00082292 predicted 3019
10 SASI_Hs01_00082293 predicted 3560
11 SASI_Hs01_00082284 predicted 3008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192730 predicted 3376
2 SASI_Hs02_00371728 predicted 3372
3 SASI_Hs01_00192731 predicted 3572
4 SASI_Hs01_00192732 predicted 3405
5 SASI_Hs01_00192733 predicted 3481
6 SASI_Hs01_00192734 predicted 3228
7 SASI_Hs01_00192735 predicted 3514
8 SASI_Hs01_00192736 predicted 3554
9 SASI_Hs01_00192737 predicted 3161
10 SASI_Hs01_00192738 predicted 3704
11 SASI_Hs01_00192729 predicted 3149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066288 predicted 3389
2 SASI_Hs02_00371729 predicted 3385
3 SASI_Hs01_00066289 predicted 3583
4 SASI_Hs01_00066290 predicted 3418
5 SASI_Hs01_00066291 predicted 3498
6 SASI_Hs01_00066292 predicted 3241
7 SASI_Hs01_00066293 predicted 3522
8 SASI_Hs01_00066294 predicted 3564
9 SASI_Hs01_00066295 predicted 3165
10 SASI_Hs01_00066296 predicted 3722
11 SASI_Hs01_00066287 predicted 3165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099492 predicted 655
2 SASI_Hs02_00371730 predicted 644
3 SASI_Hs01_00099493 predicted 850
4 SASI_Hs01_00099494 predicted 673
5 SASI_Hs01_00099495 predicted 760
6 SASI_Hs01_00099496 predicted 504
7 SASI_Hs01_00099497 predicted 779
8 SASI_Hs01_00099498 predicted 827
9 SASI_Hs01_00099499 predicted 431
10 SASI_Hs01_00099500 predicted 980
11 SASI_Hs01_00099491 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324556 predicted 2317
2 SASI_Mm01_00068514 predicted 2250
3 SASI_Mm01_00068515 predicted 2595
4 SASI_Mm01_00068516 predicted 3450
5 SASI_Mm01_00068517 predicted 3322
6 SASI_Mm01_00068518 predicted 3491
7 SASI_Mm01_00068519 predicted 3975
8 SASI_Mm01_00068521 predicted 1892
9 SASI_Mm01_00068522 predicted 2642
10 SASI_Mm01_00068523 predicted 1368
11 SASI_Mm01_00068520 predicted 2399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351879 predicted 2474
2 SASI_Mm01_00180375 predicted 2407
3 SASI_Mm01_00180376 predicted 2753
4 SASI_Mm01_00180377 predicted 3603
5 SASI_Mm01_00180378 predicted 3477
6 SASI_Mm01_00180379 predicted 3640
7 SASI_Mm01_00180380 predicted 4136
8 SASI_Mm01_00180382 predicted 2054
9 SASI_Mm01_00180383 predicted 2797
10 SASI_Mm01_00180384 predicted 1533
11 SASI_Mm01_00180381 predicted 2551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198186
ASTN2 MISSION shRNA Bacterial Glycerol Stock
astrotactin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198186.2-2296s21c1
Sequence:CCGGGTTGCGTGGAGGAGTACAAACCTCGAGGTTTGTACTCCTCCACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198186.2-4586s21c1
Sequence:CCGGGTGAGGAAGCATGGGTCTTTACTCGAGTAAAGACCCATGCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198186.2-2139s1c1
Sequence:CCGGGAGCTGAAACCCATGAAGGATCTCGAGATCCTTCATGGGTTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-3800s1c1
Sequence:CCGGGCACCACTACAACTCTCACTACTCGAGTAGTGAGAGTTGTAGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-2079s1c1
Sequence:CCGGCGCAACTTCAAGTGTGTGTCTCTCGAGAGACACACACTTGAAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-921s1c1
Sequence:CCGGCAAACCCACAATTCCGTCATTCTCGAGAATGACGGAATTGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198186.2-4248s1c1
Sequence:CCGGCAAACGGTTTCTCCTGTGGATCTCGAGATCCACAGGAGAAACCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-2389s1c1
Sequence:CCGGCCAAATTCAATGATACCCTCTCTCGAGAGAGGGTATCATTGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-3536s1c1
Sequence:CCGGCAGTATCTACTCAGTCATCTTCTCGAGAAGATGACTGAGTAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198186
ASTN2 MISSION shRNA shRNA Plasmid DNA
astrotactin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198186.2-2296s21c1
Sequence:CCGGGTTGCGTGGAGGAGTACAAACCTCGAGGTTTGTACTCCTCCACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198186.2-4586s21c1
Sequence:CCGGGTGAGGAAGCATGGGTCTTTACTCGAGTAAAGACCCATGCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198186.2-2139s1c1
Sequence:CCGGGAGCTGAAACCCATGAAGGATCTCGAGATCCTTCATGGGTTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-3800s1c1
Sequence:CCGGGCACCACTACAACTCTCACTACTCGAGTAGTGAGAGTTGTAGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-2079s1c1
Sequence:CCGGCGCAACTTCAAGTGTGTGTCTCTCGAGAGACACACACTTGAAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-921s1c1
Sequence:CCGGCAAACCCACAATTCCGTCATTCTCGAGAATGACGGAATTGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198186.2-4248s1c1
Sequence:CCGGCAAACGGTTTCTCCTGTGGATCTCGAGATCCACAGGAGAAACCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-2389s1c1
Sequence:CCGGCCAAATTCAATGATACCCTCTCTCGAGAGAGGGTATCATTGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-3536s1c1
Sequence:CCGGCAGTATCTACTCAGTCATCTTCTCGAGAAGATGACTGAGTAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198186
ASTN2 MISSION shRNA Lentiviral Transduction Particles
astrotactin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198186.2-2296s21c1
Sequence:CCGGGTTGCGTGGAGGAGTACAAACCTCGAGGTTTGTACTCCTCCACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198186.2-4586s21c1
Sequence:CCGGGTGAGGAAGCATGGGTCTTTACTCGAGTAAAGACCCATGCTTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198186.2-2139s1c1
Sequence:CCGGGAGCTGAAACCCATGAAGGATCTCGAGATCCTTCATGGGTTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-3800s1c1
Sequence:CCGGGCACCACTACAACTCTCACTACTCGAGTAGTGAGAGTTGTAGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-2079s1c1
Sequence:CCGGCGCAACTTCAAGTGTGTGTCTCTCGAGAGACACACACTTGAAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-921s1c1
Sequence:CCGGCAAACCCACAATTCCGTCATTCTCGAGAATGACGGAATTGTGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198186.2-4248s1c1
Sequence:CCGGCAAACGGTTTCTCCTGTGGATCTCGAGATCCACAGGAGAAACCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-2389s1c1
Sequence:CCGGCCAAATTCAATGATACCCTCTCTCGAGAGAGGGTATCATTGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198186.2-3536s1c1
Sequence:CCGGCAGTATCTACTCAGTCATCTTCTCGAGAAGATGACTGAGTAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019514
ASTN2 MISSION shRNA Bacterial Glycerol Stock
astrotactin 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.3-1464s1c1
Sequence:CCGGGGATATCTCCGATTGGCTAAACTCGAGTTTAGCCAATCGGAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-1464s21c1
Sequence:CCGGGGATATCTCCGATTGGCTAAACTCGAGTTTAGCCAATCGGAGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-2352s21c1
Sequence:CCGGCAACCGGACACAACATGTAAACTCGAGTTTACATGTTGTGTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019514.3-4444s21c1
Sequence:CCGGGCAAGGAAGCTTGGGTCTTTACTCGAGTAAAGACCCAAGCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-3204s21c1
Sequence:CCGGACAGCCGGTGTTACGACTTTCCTCGAGGAAAGTCGTAACACCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-3292s21c1
Sequence:CCGGACCAAAGTCTCTGACTATATTCTCGAGAATATAGTCAGAGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.2-1408s1c1
Sequence:CCGGCCTGAACACTTCATTGCAGATCTCGAGATCTGCAATGAAGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.2-616s1c1
Sequence:CCGGGCAGCGGACATTTCTTTGGTTCTCGAGAACCAAAGAAATGTCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019514
ASTN2 MISSION shRNA shRNA Plasmid DNA
astrotactin 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.3-1464s1c1
Sequence:CCGGGGATATCTCCGATTGGCTAAACTCGAGTTTAGCCAATCGGAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-1464s21c1
Sequence:CCGGGGATATCTCCGATTGGCTAAACTCGAGTTTAGCCAATCGGAGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-2352s21c1
Sequence:CCGGCAACCGGACACAACATGTAAACTCGAGTTTACATGTTGTGTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019514.3-4444s21c1
Sequence:CCGGGCAAGGAAGCTTGGGTCTTTACTCGAGTAAAGACCCAAGCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-3204s21c1
Sequence:CCGGACAGCCGGTGTTACGACTTTCCTCGAGGAAAGTCGTAACACCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-3292s21c1
Sequence:CCGGACCAAAGTCTCTGACTATATTCTCGAGAATATAGTCAGAGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.2-1408s1c1
Sequence:CCGGCCTGAACACTTCATTGCAGATCTCGAGATCTGCAATGAAGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.2-616s1c1
Sequence:CCGGGCAGCGGACATTTCTTTGGTTCTCGAGAACCAAAGAAATGTCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019514
ASTN2 MISSION shRNA Lentiviral Transduction Particles
astrotactin 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.3-1464s1c1
Sequence:CCGGGGATATCTCCGATTGGCTAAACTCGAGTTTAGCCAATCGGAGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-1464s21c1
Sequence:CCGGGGATATCTCCGATTGGCTAAACTCGAGTTTAGCCAATCGGAGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-2352s21c1
Sequence:CCGGCAACCGGACACAACATGTAAACTCGAGTTTACATGTTGTGTCCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019514.3-4444s21c1
Sequence:CCGGGCAAGGAAGCTTGGGTCTTTACTCGAGTAAAGACCCAAGCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-3204s21c1
Sequence:CCGGACAGCCGGTGTTACGACTTTCCTCGAGGAAAGTCGTAACACCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019514.3-3292s21c1
Sequence:CCGGACCAAAGTCTCTGACTATATTCTCGAGAATATAGTCAGAGACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.2-1408s1c1
Sequence:CCGGCCTGAACACTTCATTGCAGATCTCGAGATCTGCAATGAAGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019514.2-616s1c1
Sequence:CCGGGCAGCGGACATTTCTTTGGTTCTCGAGAACCAAAGAAATGTCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks