EMAIL THIS PAGE TO A FRIEND

ASXL1

additional sex combs like 1 (Drosophila)

189 Gene Product Result for
Synonyms: BOPS MDS
Gene ID:
Human(171023) Summary: This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(228790) additional sex combs like 1
Rat(311553) additional sex combs like 1
Zebrafish(403066) additional sex combs like 1 (Drosophila)
domestic cat(101100957) additional sex combs like 1 (Drosophila)
Horse(100068681) additional sex combs like 1 (Drosophila)
cow(522091) additional sex combs like 1 (Drosophila)
dog(100688017) additional sex combs like 1 (Drosophila)
chicken(428158) additional sex combs like 1 (Drosophila)
sheep(101113692) additional sex combs like 1 (Drosophila)
domestic guinea pig(100732603) additional sex combs like 1 (Drosophila)
naked mole-rat(101705975) additional sex combs like 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015338 Rosetta Predictions human pricing
XM_230750 Rosetta Predictions rat pricing
XR_008070 Rosetta Predictions rat pricing
NM_001039939 Rosetta Predictions mouse pricing
XM_001004872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200507 predicted 3419
2 SASI_Hs01_00200508 predicted 4504
3 SASI_Hs01_00200509 predicted 3041
4 SASI_Hs02_00347642 predicted 2107
5 SASI_Hs01_00200511 predicted 5009
6 SASI_Hs02_00347643 predicted 4251
7 SASI_Hs01_00200513 predicted 4345
8 SASI_Hs01_00200514 predicted 3732
9 SASI_Hs01_00200515 predicted 3626
10 SASI_Hs01_00200516 predicted 1855
11 SASI_Hs01_00200510 predicted 3134
12 SASI_Hs01_00200512 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182827 predicted 316
2 SASI_Rn01_00182828 predicted 2710
3 SASI_Rn01_00182829 predicted 3168
4 SASI_Rn01_00182830 predicted 1905
5 SASI_Rn01_00182831 predicted 1783
6 SASI_Rn01_00182832 predicted 2502
7 SASI_Rn01_00182833 predicted 2335
8 SASI_Rn01_00182834 predicted 2589
9 SASI_Rn01_00182835 predicted 3131
10 SASI_Rn01_00182836 predicted 1695
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164023 predicted 5503
2 SASI_Rn01_00164024 predicted 319
3 SASI_Rn01_00164025 predicted 3942
4 SASI_Rn01_00164026 predicted 4814
5 SASI_Rn01_00164027 predicted 5019
6 SASI_Rn01_00164028 predicted 2670
7 SASI_Rn01_00164029 predicted 2549
8 SASI_Rn02_00416150 predicted 4875
9 SASI_Rn01_00164032 predicted 3270
10 SASI_Rn02_00416151 predicted 4689
11 SASI_Rn01_00164030 predicted 5268
12 SASI_Rn01_00164031 predicted 5755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189230 predicted 516
2 SASI_Mm01_00189231 predicted 4093
3 SASI_Mm01_00189232 predicted 2767
4 SASI_Mm01_00189233 predicted 2636
5 SASI_Mm02_00290244 predicted 3984
6 SASI_Mm01_00189234 predicted 4428
7 SASI_Mm01_00189235 predicted 2842
8 SASI_Mm01_00189236 predicted 2585
9 SASI_Mm01_00189238 predicted 2739
10 SASI_Mm02_00290245 predicted 4579
11 SASI_Mm01_00189229 predicted 3998
12 SASI_Mm01_00189237 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283764 predicted 4078
2 SASI_Mm01_00283765 predicted 609
3 SASI_Mm01_00283766 predicted 4185
4 SASI_Mm01_00283767 predicted 2862
5 SASI_Mm01_00283768 predicted 2722
6 SASI_Mm01_00283769 predicted 4513
7 SASI_Mm01_00283770 predicted 2940
8 SASI_Mm01_00283771 predicted 2677
9 SASI_Mm01_00283772 predicted 966
10 SASI_Mm01_00283773 predicted 2828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015338
VALIDATED
ASXL1 MISSION shRNA Bacterial Glycerol Stock
additional sex combs like 1 (Drosophila)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.5-754s21c1
Sequence:GTACCGGGTGGAGAGCTGTGGGTCTAATCTCGAGATTAGACCCACAGCTCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015338.4-3862s21c1
Sequence:CCGGTCGCTACGCATGGGATCTTTACTCGAGTAAAGATCCCATGCGTAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-2186s21c1
Sequence:CCGGGTCAGCCCACTTACCAGATATCTCGAGATATCTGGTAAGTGGGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-1591s21c1
Sequence:CCGGCCAGGAGAATCAGTGCGTATACTCGAGTATACGCACTGATTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015338.4-5390s21c1
Sequence:CCGGTTCTCCACCAAGGGAGTTAACCTCGAGGTTAACTCCCTTGGTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-2875s21c1
Sequence:CCGGCTAGTGGGAGATGATACATTACTCGAGTAATGTATCATCTCCCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015338.5-5507s21c1
Sequence:GTACCGGGAAGCCAGCACAGGGTTAAAGCTCGAGCTTTAACCCTGTGCTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.5-5040s21c1
Sequence:GTACCGGGTGCCTTGTGGTGAGATAATACTCGAGTATTATCTCACCACAAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-1584s1c1
Sequence:CCGGCCAGGAGAATCAGTGCGTATACTCGAGTATACGCACTGATTCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015338.3-5953s1c1
Sequence:CCGGGCTTCTGTAAGTATGCTCTATCTCGAGATAGAGCATACTTACAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-1392s1c1
Sequence:CCGGGCTGATGGTGAATTTACTCATCTCGAGATGAGTAAATTCACCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-2135s1c1
Sequence:CCGGCCGGATTCAACTTTCACGTATCTCGAGATACGTGAAAGTTGAATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015338.3-4161s1c1
Sequence:CCGGGCTATGTCACAGGACAGTAATCTCGAGATTACTGTCCTGTGACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015338.3-4761s1c1
Sequence:CCGGCAACTGAGTTCCACCAGCTTTCTCGAGAAAGCTGGTGGAACTCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015338
VALIDATED
ASXL1 MISSION shRNA shRNA Plasmid DNA
additional sex combs like 1 (Drosophila)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.5-754s21c1
Sequence:GTACCGGGTGGAGAGCTGTGGGTCTAATCTCGAGATTAGACCCACAGCTCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015338.4-3862s21c1
Sequence:CCGGTCGCTACGCATGGGATCTTTACTCGAGTAAAGATCCCATGCGTAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-2186s21c1
Sequence:CCGGGTCAGCCCACTTACCAGATATCTCGAGATATCTGGTAAGTGGGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-1591s21c1
Sequence:CCGGCCAGGAGAATCAGTGCGTATACTCGAGTATACGCACTGATTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015338.4-5390s21c1
Sequence:CCGGTTCTCCACCAAGGGAGTTAACCTCGAGGTTAACTCCCTTGGTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-2875s21c1
Sequence:CCGGCTAGTGGGAGATGATACATTACTCGAGTAATGTATCATCTCCCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015338.5-5507s21c1
Sequence:GTACCGGGAAGCCAGCACAGGGTTAAAGCTCGAGCTTTAACCCTGTGCTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.5-5040s21c1
Sequence:GTACCGGGTGCCTTGTGGTGAGATAATACTCGAGTATTATCTCACCACAAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-1584s1c1
Sequence:CCGGCCAGGAGAATCAGTGCGTATACTCGAGTATACGCACTGATTCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015338.3-5953s1c1
Sequence:CCGGGCTTCTGTAAGTATGCTCTATCTCGAGATAGAGCATACTTACAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-1392s1c1
Sequence:CCGGGCTGATGGTGAATTTACTCATCTCGAGATGAGTAAATTCACCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-2135s1c1
Sequence:CCGGCCGGATTCAACTTTCACGTATCTCGAGATACGTGAAAGTTGAATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015338.3-4161s1c1
Sequence:CCGGGCTATGTCACAGGACAGTAATCTCGAGATTACTGTCCTGTGACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015338.3-4761s1c1
Sequence:CCGGCAACTGAGTTCCACCAGCTTTCTCGAGAAAGCTGGTGGAACTCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015338
VALIDATED
ASXL1 MISSION shRNA Lentiviral Transduction Particles
additional sex combs like 1 (Drosophila)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.5-754s21c1
Sequence:GTACCGGGTGGAGAGCTGTGGGTCTAATCTCGAGATTAGACCCACAGCTCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015338.4-3862s21c1
Sequence:CCGGTCGCTACGCATGGGATCTTTACTCGAGTAAAGATCCCATGCGTAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-2186s21c1
Sequence:CCGGGTCAGCCCACTTACCAGATATCTCGAGATATCTGGTAAGTGGGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-1591s21c1
Sequence:CCGGCCAGGAGAATCAGTGCGTATACTCGAGTATACGCACTGATTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015338.4-5390s21c1
Sequence:CCGGTTCTCCACCAAGGGAGTTAACCTCGAGGTTAACTCCCTTGGTGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.4-2875s21c1
Sequence:CCGGCTAGTGGGAGATGATACATTACTCGAGTAATGTATCATCTCCCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015338.5-5507s21c1
Sequence:GTACCGGGAAGCCAGCACAGGGTTAAAGCTCGAGCTTTAACCCTGTGCTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015338.5-5040s21c1
Sequence:GTACCGGGTGCCTTGTGGTGAGATAATACTCGAGTATTATCTCACCACAAGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-1584s1c1
Sequence:CCGGCCAGGAGAATCAGTGCGTATACTCGAGTATACGCACTGATTCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015338.3-5953s1c1
Sequence:CCGGGCTTCTGTAAGTATGCTCTATCTCGAGATAGAGCATACTTACAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-1392s1c1
Sequence:CCGGGCTGATGGTGAATTTACTCATCTCGAGATGAGTAAATTCACCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015338.3-2135s1c1
Sequence:CCGGCCGGATTCAACTTTCACGTATCTCGAGATACGTGAAAGTTGAATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015338.3-4161s1c1
Sequence:CCGGGCTATGTCACAGGACAGTAATCTCGAGATTACTGTCCTGTGACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015338.3-4761s1c1
Sequence:CCGGCAACTGAGTTCCACCAGCTTTCTCGAGAAAGCTGGTGGAACTCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039939
VALIDATED
ASXL1 MISSION shRNA Bacterial Glycerol Stock
additional sex combs like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039939.1-2759s21c1
Sequence:CCGGGTGCCACAGGCCTACTCATAACTCGAGTTATGAGTAGGCCTGTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039939.1-1946s21c1
Sequence:CCGGGTCGGCCCACTTACCAGATATCTCGAGATATCTGGTAAGTGGGCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039939.1-1103s21c1
Sequence:CCGGTCAGCGGCAGTGCACTCAATACTCGAGTATTGAGTGCACTGCCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039939.1-5463s21c1
Sequence:CCGGTGCCACCCACCCATCATATTTCTCGAGAAATATGATGGGTGGGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039939.1-517s21c1
Sequence:CCGGGTGGAAAGCTGTGGGTCTAATCTCGAGATTAGACCCACAGCTTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039939
VALIDATED
ASXL1 MISSION shRNA shRNA Plasmid DNA
additional sex combs like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039939.1-2759s21c1
Sequence:CCGGGTGCCACAGGCCTACTCATAACTCGAGTTATGAGTAGGCCTGTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039939.1-1946s21c1
Sequence:CCGGGTCGGCCCACTTACCAGATATCTCGAGATATCTGGTAAGTGGGCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039939.1-1103s21c1
Sequence:CCGGTCAGCGGCAGTGCACTCAATACTCGAGTATTGAGTGCACTGCCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039939.1-5463s21c1
Sequence:CCGGTGCCACCCACCCATCATATTTCTCGAGAAATATGATGGGTGGGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039939.1-517s21c1
Sequence:CCGGGTGGAAAGCTGTGGGTCTAATCTCGAGATTAGACCCACAGCTTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039939
VALIDATED
ASXL1 MISSION shRNA Lentiviral Transduction Particles
additional sex combs like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039939.1-2759s21c1
Sequence:CCGGGTGCCACAGGCCTACTCATAACTCGAGTTATGAGTAGGCCTGTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039939.1-1946s21c1
Sequence:CCGGGTCGGCCCACTTACCAGATATCTCGAGATATCTGGTAAGTGGGCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039939.1-1103s21c1
Sequence:CCGGTCAGCGGCAGTGCACTCAATACTCGAGTATTGAGTGCACTGCCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039939.1-5463s21c1
Sequence:CCGGTGCCACCCACCCATCATATTTCTCGAGAAATATGATGGGTGGGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039939.1-517s21c1
Sequence:CCGGGTGGAAAGCTGTGGGTCTAATCTCGAGATTAGACCCACAGCTTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)