EMAIL THIS PAGE TO A FRIEND

ASXL2

additional sex combs like 2 (Drosophila)

87 Gene Product Result for
Synonyms: ASXH2
Gene ID:
Human(55252) Summary: ASXL2 is a human homolog of the Drosophila asx gene. Drosophila asx is an enhancer of trithorax (see MIM 159555) and polycomb (see MIM 610231) (ETP) gene that encodes a chromatin protein with dual functions in transcriptional activation and silencing (Katoh and Katoh, 2003 [PubMed 12888926]
Mouse(75302) additional sex combs like 2 (Drosophila)
Rat(313922) additional sex combs like 2 (Drosophila)
naked mole-rat(101721898) additional sex combs like 2 (Drosophila)
domestic guinea pig(100719241) additional sex combs like 2 (Drosophila)
sheep(101109427) additional sex combs like 2 (Drosophila)
chicken(421993) additional sex combs like 2 (Drosophila)
cow(100140419) additional sex combs like 2 (Drosophila)
Horse(100071411) additional sex combs like 2 (Drosophila)
domestic cat(101085457) additional sex combs like 2 (Drosophila)
dog(100684260) additional sex combs like 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018263 Rosetta Predictions human pricing
NM_001108011 Rosetta Predictions rat pricing
NM_172421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202197 predicted 3898
2 SASI_Hs01_00202198 predicted 3949
3 SASI_Hs01_00202199 predicted 1190
4 SASI_Hs01_00202200 predicted 4181
5 SASI_Hs01_00202201 predicted 4232
6 SASI_Hs01_00202202 predicted 1864
7 SASI_Hs01_00202203 predicted 3058
8 SASI_Hs01_00202204 predicted 2783
9 SASI_Hs02_00351630 predicted 3372
10 SASI_Hs01_00202206 predicted 3043
11 SASI_Hs01_00202205 predicted 2845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234485 predicted 1918
2 SASI_Rn02_00234486 predicted 2730
3 SASI_Rn02_00234487 predicted 4138
4 SASI_Rn02_00234488 predicted 3565
5 SASI_Rn02_00234489 predicted 3549
6 SASI_Rn02_00234490 predicted 1722
7 SASI_Rn02_00234491 predicted 3608
8 SASI_Rn02_00234492 predicted 1654
9 SASI_Rn02_00234493 predicted 1492
10 SASI_Rn02_00234494 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180272 predicted 4096
2 SASI_Mm01_00180273 predicted 3888
3 SASI_Mm01_00180274 predicted 2490
4 SASI_Mm01_00180275 predicted 1556
5 SASI_Mm01_00180276 predicted 955
6 SASI_Mm01_00180277 predicted 723
7 SASI_Mm02_00343895 predicted 4381
8 SASI_Mm01_00180278 predicted 480
9 SASI_Mm01_00180279 predicted 3291
10 SASI_Mm01_00180280 predicted 3447
11 SASI_Mm01_00180271 predicted 3801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172421
VALIDATED
ASXL2 MISSION shRNA Bacterial Glycerol Stock
additional sex combs like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-2269s1c1
Sequence:CCGGCCCAGTCAGTACAAATGGAAACTCGAGTTTCCATTTGTACTGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-4163s1c1
Sequence:CCGGCCTGCCAGTCAAGCAATGAATCTCGAGATTCATTGCTTGACTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172421.1-1543s1c1
Sequence:CCGGGAAACCCATCAAGAGCCCTAACTCGAGTTAGGGCTCTTGATGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-1305s1c1
Sequence:CCGGCCTCAAGTGATCCCAAAGCAACTCGAGTTGCTTTGGGATCACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172421.1-3866s1c1
Sequence:CCGGGCACATAAACAGATGACTCATCTCGAGATGAGTCATCTGTTTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4542s21c1
Sequence:CCGGTATAGTAGGTCTGAGTCAAATCTCGAGATTTGACTCAGACCTACTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172421.3-958s21c1
Sequence:CCGGCTGATTCCATTCTGGTTAATACTCGAGTATTAACCAGAATGGAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4504s21c1
Sequence:CCGGAGAATGCAGGTCTTCACATTTCTCGAGAAATGTGAAGACCTGCATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4783s21c1
Sequence:CCGGGCGATCATAGTGCTGATTATGCTCGAGCATAATCAGCACTATGATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172421.3-349s21c1
Sequence:CCGGATACACCCATGAGTCATAAAGCTCGAGCTTTATGACTCATGGGTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172421
VALIDATED
ASXL2 MISSION shRNA shRNA Plasmid DNA
additional sex combs like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-2269s1c1
Sequence:CCGGCCCAGTCAGTACAAATGGAAACTCGAGTTTCCATTTGTACTGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-4163s1c1
Sequence:CCGGCCTGCCAGTCAAGCAATGAATCTCGAGATTCATTGCTTGACTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172421.1-1543s1c1
Sequence:CCGGGAAACCCATCAAGAGCCCTAACTCGAGTTAGGGCTCTTGATGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-1305s1c1
Sequence:CCGGCCTCAAGTGATCCCAAAGCAACTCGAGTTGCTTTGGGATCACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172421.1-3866s1c1
Sequence:CCGGGCACATAAACAGATGACTCATCTCGAGATGAGTCATCTGTTTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4542s21c1
Sequence:CCGGTATAGTAGGTCTGAGTCAAATCTCGAGATTTGACTCAGACCTACTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172421.3-958s21c1
Sequence:CCGGCTGATTCCATTCTGGTTAATACTCGAGTATTAACCAGAATGGAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4504s21c1
Sequence:CCGGAGAATGCAGGTCTTCACATTTCTCGAGAAATGTGAAGACCTGCATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4783s21c1
Sequence:CCGGGCGATCATAGTGCTGATTATGCTCGAGCATAATCAGCACTATGATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172421.3-349s21c1
Sequence:CCGGATACACCCATGAGTCATAAAGCTCGAGCTTTATGACTCATGGGTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172421
VALIDATED
ASXL2 MISSION shRNA Lentiviral Transduction Particles
additional sex combs like 2 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-2269s1c1
Sequence:CCGGCCCAGTCAGTACAAATGGAAACTCGAGTTTCCATTTGTACTGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-4163s1c1
Sequence:CCGGCCTGCCAGTCAAGCAATGAATCTCGAGATTCATTGCTTGACTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172421.1-1543s1c1
Sequence:CCGGGAAACCCATCAAGAGCCCTAACTCGAGTTAGGGCTCTTGATGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172421.1-1305s1c1
Sequence:CCGGCCTCAAGTGATCCCAAAGCAACTCGAGTTGCTTTGGGATCACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172421.1-3866s1c1
Sequence:CCGGGCACATAAACAGATGACTCATCTCGAGATGAGTCATCTGTTTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4542s21c1
Sequence:CCGGTATAGTAGGTCTGAGTCAAATCTCGAGATTTGACTCAGACCTACTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172421.3-958s21c1
Sequence:CCGGCTGATTCCATTCTGGTTAATACTCGAGTATTAACCAGAATGGAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4504s21c1
Sequence:CCGGAGAATGCAGGTCTTCACATTTCTCGAGAAATGTGAAGACCTGCATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172421.3-4783s21c1
Sequence:CCGGGCGATCATAGTGCTGATTATGCTCGAGCATAATCAGCACTATGATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172421.3-349s21c1
Sequence:CCGGATACACCCATGAGTCATAAAGCTCGAGCTTTATGACTCATGGGTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018263
ASXL2 MISSION shRNA Bacterial Glycerol Stock
additional sex combs like 2 (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-307s1c1
Sequence:CCGGCCAGGTAGAATGGGAGTATATCTCGAGATATACTCCCATTCTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-1634s1c1
Sequence:CCGGGCCAAGAATCTTTAGTTACATCTCGAGATGTAACTAAAGATTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-904s1c1
Sequence:CCGGCCGGACTCCATTCTGGTTAATCTCGAGATTAACCAGAATGGAGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-653s1c1
Sequence:CCGGCCAACCAGCATCTCTCACTAACTCGAGTTAGTGAGAGATGCTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018263.4-713s21c1
Sequence:CCGGGGCACTAAAGCAGGCGCTAAACTCGAGTTTAGCGCCTGCTTTAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018263.4-298s21c1
Sequence:CCGGATACACCCATGAGTCATAAAGCTCGAGCTTTATGACTCATGGGTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018263
ASXL2 MISSION shRNA shRNA Plasmid DNA
additional sex combs like 2 (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-307s1c1
Sequence:CCGGCCAGGTAGAATGGGAGTATATCTCGAGATATACTCCCATTCTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-1634s1c1
Sequence:CCGGGCCAAGAATCTTTAGTTACATCTCGAGATGTAACTAAAGATTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-904s1c1
Sequence:CCGGCCGGACTCCATTCTGGTTAATCTCGAGATTAACCAGAATGGAGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-653s1c1
Sequence:CCGGCCAACCAGCATCTCTCACTAACTCGAGTTAGTGAGAGATGCTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018263.4-713s21c1
Sequence:CCGGGGCACTAAAGCAGGCGCTAAACTCGAGTTTAGCGCCTGCTTTAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018263.4-298s21c1
Sequence:CCGGATACACCCATGAGTCATAAAGCTCGAGCTTTATGACTCATGGGTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018263
ASXL2 MISSION shRNA Lentiviral Transduction Particles
additional sex combs like 2 (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-307s1c1
Sequence:CCGGCCAGGTAGAATGGGAGTATATCTCGAGATATACTCCCATTCTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-1634s1c1
Sequence:CCGGGCCAAGAATCTTTAGTTACATCTCGAGATGTAACTAAAGATTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-904s1c1
Sequence:CCGGCCGGACTCCATTCTGGTTAATCTCGAGATTAACCAGAATGGAGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018263.2-653s1c1
Sequence:CCGGCCAACCAGCATCTCTCACTAACTCGAGTTAGTGAGAGATGCTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018263.4-713s21c1
Sequence:CCGGGGCACTAAAGCAGGCGCTAAACTCGAGTTTAGCGCCTGCTTTAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018263.4-298s21c1
Sequence:CCGGATACACCCATGAGTCATAAAGCTCGAGCTTTATGACTCATGGGTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)