EMAIL THIS PAGE TO A FRIEND

ASXL3

additional sex combs like 3 (Drosophila)

147 Gene Product Result for
Synonyms: KIAA1713
UniProtKB ID: Q9C0F0, Q6ZMX6, Q96MU3, Q9UFC5
Gene ID:
Mouse(211961) additional sex combs like 3 (Drosophila)
Rat(307555) additional sex combs like 3 (Drosophila)
chicken(421102) additional sex combs like 3 (Drosophila)
dog(490492) additional sex combs like 3 (Drosophila)
domestic cat(101096611) additional sex combs like 3 (Drosophila)
cow(538107) additional sex combs like 3 (Drosophila)
Horse(100066642) additional sex combs like 3 (Drosophila)
sheep(101117128) additional sex combs like 3 (Drosophila)
Domestic Rabbit(100350652) additional sex combs like 3 (Drosophila)
domestic guinea pig(100733150) additional sex combs like 3 (Drosophila)
naked mole-rat(101700685) additional sex combs like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030632 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030632 Rosetta Predictions human pricing
XM_290811 Rosetta Predictions human pricing
XM_932880 Rosetta Predictions human pricing
XM_932884 Rosetta Predictions human pricing
XM_226128 Rosetta Predictions rat pricing
XR_007410 Rosetta Predictions rat pricing
XM_001474902 Rosetta Predictions mouse pricing
XM_140204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358198 predicted 3861
2 SASI_Hs02_00358199 predicted 2171
3 SASI_Hs02_00358200 predicted 3367
4 SASI_Hs02_00358201 predicted 5561
5 SASI_Hs02_00358202 predicted 830
6 SASI_Hs02_00358203 predicted 5349
7 SASI_Hs02_00358204 predicted 3608
8 SASI_Hs02_00358205 predicted 579
9 SASI_Hs02_00358206 predicted 3623
10 SASI_Hs02_00358207 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293310 predicted 3903
2 SASI_Hs01_00293311 predicted 2214
3 SASI_Hs01_00293312 predicted 2932
4 SASI_Hs01_00293313 predicted 5112
5 SASI_Hs01_00293314 predicted 3403
6 SASI_Hs01_00293315 predicted 4420
7 SASI_Hs01_00293316 predicted 5397
8 SASI_Hs01_00293317 predicted 3644
9 SASI_Hs01_00293318 predicted 3673
10 SASI_Hs01_00293319 predicted 3686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264035 predicted 478
2 SASI_Hs01_00264036 predicted 364
3 SASI_Hs01_00264037 predicted 304
4 SASI_Hs01_00264038 predicted 747
5 SASI_Hs01_00264039 predicted 493
6 SASI_Hs01_00264040 predicted 388
7 SASI_Hs01_00264041 predicted 303
8 SASI_Hs01_00264042 predicted 372
9 SASI_Hs01_00264043 predicted 292
10 SASI_Hs01_00264044 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281431 predicted 2213
2 SASI_Hs01_00281432 predicted 1889
3 SASI_Hs01_00281433 predicted 2929
4 SASI_Hs01_00281434 predicted 3410
5 SASI_Hs01_00281435 predicted 2185
6 SASI_Hs01_00281436 predicted 1202
7 SASI_Hs01_00281437 predicted 3433
8 SASI_Hs01_00281438 predicted 1993
9 SASI_Hs01_00281439 predicted 2323
10 SASI_Hs01_00281440 predicted 2205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383350 predicted 1904
2 SASI_Rn02_00383351 predicted 5592
3 SASI_Rn02_00383352 predicted 5857
4 SASI_Rn02_00383353 predicted 6565
5 SASI_Rn02_00383354 predicted 4477
6 SASI_Rn02_00383355 predicted 1500
7 SASI_Rn02_00383356 predicted 2939
8 SASI_Rn02_00383357 predicted 5673
9 SASI_Rn02_00383358 predicted 5044
10 SASI_Rn02_00383359 predicted 5028
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00414501 predicted 1914
2 SASI_Rn01_00177242 predicted 5594
3 SASI_Rn01_00177244 predicted 5867
4 SASI_Rn01_00177245 predicted 6915
5 SASI_Rn02_00414502 predicted 4485
6 SASI_Rn01_00177247 predicted 1507
7 SASI_Rn01_00177249 predicted 2949
8 SASI_Rn02_00414503 predicted 5681
9 SASI_Rn01_00177250 predicted 5050
10 SASI_Rn02_00414504 predicted 5040
11 SASI_Rn01_00177243 predicted 1012
12 SASI_Rn01_00177246 predicted 1142
13 SASI_Rn01_00177248 predicted 7080
14 SASI_Rn01_00177251 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378671 predicted 2999
2 SASI_Mm02_00378672 predicted 4209
3 SASI_Mm02_00378673 predicted 2870
4 SASI_Mm02_00378674 predicted 2486
5 SASI_Mm02_00378675 predicted 3950
6 SASI_Mm02_00378676 predicted 5068
7 SASI_Mm02_00378677 predicted 4225
8 SASI_Mm02_00378678 predicted 798
9 SASI_Mm02_00378679 predicted 294
10 SASI_Mm02_00378680 predicted 3835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424935 predicted 3069
2 SASI_Mm02_00424936 predicted 4275
3 SASI_Mm02_00424937 predicted 2933
4 SASI_Mm02_00424938 predicted 2550
5 SASI_Mm02_00424939 predicted 4014
6 SASI_Mm02_00424940 predicted 5102
7 SASI_Mm02_00424941 predicted 4288
8 SASI_Mm02_00424942 predicted 862
9 SASI_Mm02_00424943 predicted 351
10 SASI_Mm02_00424944 predicted 3897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030632
ASXL3 MISSION shRNA Bacterial Glycerol Stock
additional sex combs like 3 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-3009s21c1
Sequence:CCGGATCAGTCAACCCGGAACATATCTCGAGATATGTTCCGGGTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-2136s21c1
Sequence:CCGGTTATGTCCAACTTACCATTAACTCGAGTTAATGGTAAGTTGGACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-2472s21c1
Sequence:CCGGATACTCCCGAACCCATCATAACTCGAGTTATGATGGGTTCGGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-3785s21c1
Sequence:CCGGGCTATATCGGGAGCAATTAAACTCGAGTTTAATTGCTCCCGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030632.1-7367s21c1
Sequence:CCGGATCCACTGTCCTGAGTATTATCTCGAGATAATACTCAGGACAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030632
ASXL3 MISSION shRNA shRNA Plasmid DNA
additional sex combs like 3 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-3009s21c1
Sequence:CCGGATCAGTCAACCCGGAACATATCTCGAGATATGTTCCGGGTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-2136s21c1
Sequence:CCGGTTATGTCCAACTTACCATTAACTCGAGTTAATGGTAAGTTGGACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-2472s21c1
Sequence:CCGGATACTCCCGAACCCATCATAACTCGAGTTATGATGGGTTCGGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-3785s21c1
Sequence:CCGGGCTATATCGGGAGCAATTAAACTCGAGTTTAATTGCTCCCGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030632.1-7367s21c1
Sequence:CCGGATCCACTGTCCTGAGTATTATCTCGAGATAATACTCAGGACAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030632
ASXL3 MISSION shRNA Lentiviral Transduction Particles
additional sex combs like 3 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-3009s21c1
Sequence:CCGGATCAGTCAACCCGGAACATATCTCGAGATATGTTCCGGGTTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-2136s21c1
Sequence:CCGGTTATGTCCAACTTACCATTAACTCGAGTTAATGGTAAGTTGGACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-2472s21c1
Sequence:CCGGATACTCCCGAACCCATCATAACTCGAGTTATGATGGGTTCGGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030632.1-3785s21c1
Sequence:CCGGGCTATATCGGGAGCAATTAAACTCGAGTTTAATTGCTCCCGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030632.1-7367s21c1
Sequence:CCGGATCCACTGTCCTGAGTATTATCTCGAGATAATACTCAGGACAGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks