EMAIL THIS PAGE TO A FRIEND

ASZ1

ankyrin repeat, SAM and basic leucine zipper domain containing 1

78 Gene Product Result for
Synonyms: ALP1 ANKL1 C7orf7 CT1.19 GASZ Orf3
UniProtKB ID: Q8WWH4, A0AV27, A4D0V0
Gene ID:
Mouse(74068) ankyrin repeat, SAM and basic leucine zipper domain containing 1
Rat(170578) ankyrin repeat, SAM and basic leucine zipper domain containing 1
Zebrafish(572911) ankyrin repeat, SAM and basic leucine zipper domain containing 1
chicken(417768) ankyrin repeat, SAM and basic leucine zipper domain containing 1
Horse(100071245) ankyrin repeat, SAM and basic leucine zipper domain containing 1
cow(281184) ankyrin repeat, SAM and basic leucine zipper domain containing 1
domestic cat(445569) ankyrin repeat, SAM and basic leucine zipper domain containing 1
dog(610199) ankyrin repeat, SAM and basic leucine zipper domain containing 1
naked mole-rat(101723211) ankyrin repeat, SAM and basic leucine zipper domain containing 1
domestic guinea pig(100135638) ankyrin repeat, SAM and basic leucine zipper domain containing 1
domestic guinea pig(100719623) ankyrin repeat, SAM and basic leucine zipper domain containing 1
sheep(100126570) ankyrin repeat, SAM and basic leucine zipper domain containing 1
Domestic Rabbit(100126561) ankyrin repeat, SAM and basic leucine zipper domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130768 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130768 Rosetta Predictions human pricing
NR_023315 Rosetta Predictions human pricing
NM_130750 Rosetta Predictions rat pricing
NM_023729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104607 predicted 515
2 SASI_Hs01_00104608 predicted 828
3 SASI_Hs02_00362784 predicted 1009
4 SASI_Hs01_00104609 predicted 1066
5 SASI_Hs01_00104610 predicted 1163
6 SASI_Hs01_00104611 predicted 1114
7 SASI_Hs02_00362785 predicted 914
8 SASI_Hs01_00104612 predicted 248
9 SASI_Hs01_00104614 predicted 445
10 SASI_Hs02_00362786 predicted 549
11 SASI_Hs01_00104613 predicted 1172
12 SASI_Hs01_00104615 predicted 1095
13 SASI_Hs01_00104616 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381632 predicted 513
2 SASI_Hs02_00381633 predicted 830
3 SASI_Hs02_00381634 predicted 1015
4 SASI_Hs02_00381635 predicted 1070
5 SASI_Hs02_00381636 predicted 1157
6 SASI_Hs02_00381637 predicted 1112
7 SASI_Hs02_00381638 predicted 917
8 SASI_Hs02_00381639 predicted 249
9 SASI_Hs02_00381640 predicted 439
10 SASI_Hs02_00381641 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119582 predicted 421
2 SASI_Rn01_00119583 predicted 320
3 SASI_Rn01_00119584 predicted 758
4 SASI_Rn01_00119585 predicted 1216
5 SASI_Rn01_00119586 predicted 966
6 SASI_Rn01_00119588 predicted 461
7 SASI_Rn01_00119589 predicted 768
8 SASI_Rn01_00119590 predicted 1044
9 SASI_Rn01_00119591 predicted 948
10 SASI_Rn02_00267485 predicted 1314
11 SASI_Rn01_00119587 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122463 predicted 402
2 SASI_Mm01_00122464 predicted 458
3 SASI_Mm01_00122465 predicted 325
4 SASI_Mm01_00122466 predicted 1313
5 SASI_Mm01_00122467 predicted 1215
6 SASI_Mm01_00122468 predicted 1068
7 SASI_Mm02_00327307 predicted 1162
8 SASI_Mm01_00122469 predicted 618
9 SASI_Mm01_00122470 predicted 813
10 SASI_Mm01_00122471 predicted 433
11 SASI_Mm01_00122472 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023729
ASZ1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat, SAM and basic leucine zipper domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023729.3-1421s21c1
Sequence:CCGGTTCATCGGCAAGCTAACTTTGCTCGAGCAAAGTTAGCTTGCCGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023729.3-628s21c1
Sequence:CCGGGCTTGAACTGGGAGCTAATAACTCGAGTTATTAGCTCCCAGTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023729.2-1544s1c1
Sequence:CCGGCCTGTACTCCAAAGGAACAATCTCGAGATTGTTCCTTTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-1141s1c1
Sequence:CCGGGCAGAATATCATTACCGAGTTCTCGAGAACTCGGTAATGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-549s1c1
Sequence:CCGGCCCAGGATGAGAATGGTTATACTCGAGTATAACCATTCTCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-548s1c1
Sequence:CCGGGCCCAGGATGAGAATGGTTATCTCGAGATAACCATTCTCATCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-438s1c1
Sequence:CCGGCGGACCCAAATACTGCTTGTACTCGAGTACAAGCAGTATTTGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023729
ASZ1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat, SAM and basic leucine zipper domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023729.3-1421s21c1
Sequence:CCGGTTCATCGGCAAGCTAACTTTGCTCGAGCAAAGTTAGCTTGCCGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023729.3-628s21c1
Sequence:CCGGGCTTGAACTGGGAGCTAATAACTCGAGTTATTAGCTCCCAGTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023729.2-1544s1c1
Sequence:CCGGCCTGTACTCCAAAGGAACAATCTCGAGATTGTTCCTTTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-1141s1c1
Sequence:CCGGGCAGAATATCATTACCGAGTTCTCGAGAACTCGGTAATGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-549s1c1
Sequence:CCGGCCCAGGATGAGAATGGTTATACTCGAGTATAACCATTCTCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-548s1c1
Sequence:CCGGGCCCAGGATGAGAATGGTTATCTCGAGATAACCATTCTCATCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-438s1c1
Sequence:CCGGCGGACCCAAATACTGCTTGTACTCGAGTACAAGCAGTATTTGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023729
ASZ1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat, SAM and basic leucine zipper domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023729.3-1421s21c1
Sequence:CCGGTTCATCGGCAAGCTAACTTTGCTCGAGCAAAGTTAGCTTGCCGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023729.3-628s21c1
Sequence:CCGGGCTTGAACTGGGAGCTAATAACTCGAGTTATTAGCTCCCAGTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023729.2-1544s1c1
Sequence:CCGGCCTGTACTCCAAAGGAACAATCTCGAGATTGTTCCTTTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-1141s1c1
Sequence:CCGGGCAGAATATCATTACCGAGTTCTCGAGAACTCGGTAATGATATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-549s1c1
Sequence:CCGGCCCAGGATGAGAATGGTTATACTCGAGTATAACCATTCTCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-548s1c1
Sequence:CCGGGCCCAGGATGAGAATGGTTATCTCGAGATAACCATTCTCATCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023729.2-438s1c1
Sequence:CCGGCGGACCCAAATACTGCTTGTACTCGAGTACAAGCAGTATTTGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130768
ASZ1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat, SAM and basic leucine zipper domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130768.2-1418s21c1
Sequence:CCGGAGAGGACAGCTATTACCATATCTCGAGATATGGTAATAGCTGTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130768.2-1557s21c1
Sequence:CCGGACTGTTTGCAGCACAATATAACTCGAGTTATATTGTGCTGCAAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-186s1c1
Sequence:CCGGGCAATGACCATCGGAGATGTTCTCGAGAACATCTCCGATGGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-405s1c1
Sequence:CCGGGAACAGATCTTGAAGTGTGTACTCGAGTACACACTTCAAGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-1433s1c1
Sequence:CCGGCAAGCTAACTTTCCAGAGGAACTCGAGTTCCTCTGGAAAGTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130768.1-1432s1c1
Sequence:CCGGGCAAGCTAACTTTCCAGAGGACTCGAGTCCTCTGGAAAGTTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-546s1c1
Sequence:CCGGGCAGAAGTTAATACCCAGGATCTCGAGATCCTGGGTATTAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-1038s1c1
Sequence:CCGGGAGATACAATTTGGAGAGCTACTCGAGTAGCTCTCCAAATTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130768
ASZ1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat, SAM and basic leucine zipper domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130768.2-1418s21c1
Sequence:CCGGAGAGGACAGCTATTACCATATCTCGAGATATGGTAATAGCTGTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130768.2-1557s21c1
Sequence:CCGGACTGTTTGCAGCACAATATAACTCGAGTTATATTGTGCTGCAAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-186s1c1
Sequence:CCGGGCAATGACCATCGGAGATGTTCTCGAGAACATCTCCGATGGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-405s1c1
Sequence:CCGGGAACAGATCTTGAAGTGTGTACTCGAGTACACACTTCAAGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-1433s1c1
Sequence:CCGGCAAGCTAACTTTCCAGAGGAACTCGAGTTCCTCTGGAAAGTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130768.1-1432s1c1
Sequence:CCGGGCAAGCTAACTTTCCAGAGGACTCGAGTCCTCTGGAAAGTTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-546s1c1
Sequence:CCGGGCAGAAGTTAATACCCAGGATCTCGAGATCCTGGGTATTAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-1038s1c1
Sequence:CCGGGAGATACAATTTGGAGAGCTACTCGAGTAGCTCTCCAAATTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130768
ASZ1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat, SAM and basic leucine zipper domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130768.2-1418s21c1
Sequence:CCGGAGAGGACAGCTATTACCATATCTCGAGATATGGTAATAGCTGTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130768.2-1557s21c1
Sequence:CCGGACTGTTTGCAGCACAATATAACTCGAGTTATATTGTGCTGCAAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-186s1c1
Sequence:CCGGGCAATGACCATCGGAGATGTTCTCGAGAACATCTCCGATGGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-405s1c1
Sequence:CCGGGAACAGATCTTGAAGTGTGTACTCGAGTACACACTTCAAGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-1433s1c1
Sequence:CCGGCAAGCTAACTTTCCAGAGGAACTCGAGTTCCTCTGGAAAGTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130768.1-1432s1c1
Sequence:CCGGGCAAGCTAACTTTCCAGAGGACTCGAGTCCTCTGGAAAGTTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-546s1c1
Sequence:CCGGGCAGAAGTTAATACCCAGGATCTCGAGATCCTGGGTATTAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130768.1-1038s1c1
Sequence:CCGGGAGATACAATTTGGAGAGCTACTCGAGTAGCTCTCCAAATTGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks