EMAIL THIS PAGE TO A FRIEND

ATAD1

ATPase family, AAA domain containing 1

146 Gene Product Result for
Synonyms: AFDC1 THORASE
Gene ID:
Mouse(67979) ATPase family, AAA domain containing 1
Rat(309532) ATPase family, AAA domain containing 1
chicken(423676) ATPase family, AAA domain containing 1
cow(506045) ATPase family, AAA domain containing 1
Horse(100062416) ATPase family, AAA domain containing 1
dog(477584) ATPase family, AAA domain containing 1
domestic cat(101091402) ATPase family, AAA domain containing 1
sheep(101119092) ATPase family, AAA domain containing 1
Domestic Rabbit(100358456) ATPase family, AAA domain containing 1
naked mole-rat(101714574) ATPase family, AAA domain containing 1
domestic guinea pig(100715903) ATPase family, AAA domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032810 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107311 MISSION® esiRNA esiRNA human AFDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032810 Rosetta Predictions human pricing
NM_001035002 Rosetta Predictions rat pricing
NM_026487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200046 predicted 460
2 SASI_Hs02_00360379 predicted 1174
3 SASI_Hs01_00200047 predicted 817
4 SASI_Hs01_00200048 predicted 1504
5 SASI_Hs01_00200049 predicted 633
6 SASI_Hs01_00200050 predicted 1124
7 SASI_Hs02_00360380 predicted 1117
8 SASI_Hs01_00200051 predicted 1211
9 SASI_Hs01_00200052 predicted 595
10 SASI_Hs01_00200053 predicted 494
11 SASI_Hs01_00200054 predicted 935
12 SASI_Hs01_00200055 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111941 predicted 521
2 SASI_Rn01_00111942 predicted 599
3 SASI_Rn01_00111943 predicted 293
4 SASI_Rn01_00111944 predicted 659
5 SASI_Rn01_00111945 predicted 657
6 SASI_Rn01_00111946 predicted 247
7 SASI_Rn01_00111947 predicted 685
8 SASI_Rn01_00111948 predicted 589
9 SASI_Rn01_00111949 predicted 579
10 SASI_Rn01_00111950 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169157 predicted 1200
2 SASI_Mm01_00169158 predicted 262
3 SASI_Mm01_00169159 predicted 295
4 SASI_Mm01_00169160 predicted 527
5 SASI_Mm01_00169161 predicted 718
6 SASI_Mm01_00169162 predicted 540
7 SASI_Mm01_00169163 predicted 1180
8 SASI_Mm01_00169164 predicted 674
9 SASI_Mm02_00330359 predicted 1071
10 SASI_Mm01_00169165 predicted 635
11 SASI_Mm01_00169166 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026487
VALIDATED
ATAD1 MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-2511s1c1
Sequence:CCGGGCCAAGAAACATATCCTGTTTCTCGAGAAACAGGATATGTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026487.2-674s1c1
Sequence:CCGGGCGATGATGAAAGCTCAGTTTCTCGAGAAACTGAGCTTTCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-799s1c1
Sequence:CCGGGCCTACACGATTTCATATTAACTCGAGTTAATATGAAATCGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-281s1c1
Sequence:CCGGCATCTAGTAGACCCTCTTAATCTCGAGATTAAGAGGGTCTACTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-304s1c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-281s21c1
Sequence:CCGGCATCTAGTAGACCCTCTTAATCTCGAGATTAAGAGGGTCTACTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-304s21c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-674s21c1
Sequence:CCGGGCGATGATGAAAGCTCAGTTTCTCGAGAAACTGAGCTTTCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-799s21c1
Sequence:CCGGGCCTACACGATTTCATATTAACTCGAGTTAATATGAAATCGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026487
VALIDATED
ATAD1 MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-2511s1c1
Sequence:CCGGGCCAAGAAACATATCCTGTTTCTCGAGAAACAGGATATGTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026487.2-674s1c1
Sequence:CCGGGCGATGATGAAAGCTCAGTTTCTCGAGAAACTGAGCTTTCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-799s1c1
Sequence:CCGGGCCTACACGATTTCATATTAACTCGAGTTAATATGAAATCGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-281s1c1
Sequence:CCGGCATCTAGTAGACCCTCTTAATCTCGAGATTAAGAGGGTCTACTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-304s1c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-281s21c1
Sequence:CCGGCATCTAGTAGACCCTCTTAATCTCGAGATTAAGAGGGTCTACTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-304s21c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-674s21c1
Sequence:CCGGGCGATGATGAAAGCTCAGTTTCTCGAGAAACTGAGCTTTCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-799s21c1
Sequence:CCGGGCCTACACGATTTCATATTAACTCGAGTTAATATGAAATCGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026487
VALIDATED
ATAD1 MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-2511s1c1
Sequence:CCGGGCCAAGAAACATATCCTGTTTCTCGAGAAACAGGATATGTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026487.2-674s1c1
Sequence:CCGGGCGATGATGAAAGCTCAGTTTCTCGAGAAACTGAGCTTTCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-799s1c1
Sequence:CCGGGCCTACACGATTTCATATTAACTCGAGTTAATATGAAATCGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-281s1c1
Sequence:CCGGCATCTAGTAGACCCTCTTAATCTCGAGATTAAGAGGGTCTACTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026487.2-304s1c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-281s21c1
Sequence:CCGGCATCTAGTAGACCCTCTTAATCTCGAGATTAAGAGGGTCTACTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-304s21c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-674s21c1
Sequence:CCGGGCGATGATGAAAGCTCAGTTTCTCGAGAAACTGAGCTTTCATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026487.3-799s21c1
Sequence:CCGGGCCTACACGATTTCATATTAACTCGAGTTAATATGAAATCGTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032810
VALIDATED
ATAD1 MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_032810.2-2460s1c1
Sequence:CCGGGCTGTTACTAAGTGTGCTAAACTCGAGTTTAGCACACTTAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-671s1c1
Sequence:CCGGGATGTCATTACGGATCTGAAACTCGAGTTTCAGATCCGTAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032810.2-481s1c1
Sequence:CCGGCAAATGGATGGTAGATGCAATCTCGAGATTGCATCTACCATCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-1411s1c1
Sequence:CCGGGAAATCAAAGGATGCAGCATTCTCGAGAATGCTGCATCCTTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-637s1c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_032810.2-1709s1c1
Sequence:CCGGGCCATATATTGTACAGCCTTACTCGAGTAAGGCTGTACAATATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-824s21c1
Sequence:CCGGGAAGCAGGCTGTCGATTTATTCTCGAGAATAAATCGACAGCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-639s21c1
Sequence:CCGGATGTTACTTGGAGTGATATAGCTCGAGCTATATCACTCCAAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-456s21c1
Sequence:CCGGTTGGTGCAGTGACATACTTTACTCGAGTAAAGTATGTCACTGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-1102s21c1
Sequence:CCGGGGACCTTGACTCGGCTATAATCTCGAGATTATAGCCGAGTCAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032810.2-2826s21c1
Sequence:CCGGGAATCTGTTAGATCGTTTATTCTCGAGAATAAACGATCTAACAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032810
VALIDATED
ATAD1 MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_032810.2-2460s1c1
Sequence:CCGGGCTGTTACTAAGTGTGCTAAACTCGAGTTTAGCACACTTAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-671s1c1
Sequence:CCGGGATGTCATTACGGATCTGAAACTCGAGTTTCAGATCCGTAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032810.2-481s1c1
Sequence:CCGGCAAATGGATGGTAGATGCAATCTCGAGATTGCATCTACCATCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-1411s1c1
Sequence:CCGGGAAATCAAAGGATGCAGCATTCTCGAGAATGCTGCATCCTTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-637s1c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_032810.2-1709s1c1
Sequence:CCGGGCCATATATTGTACAGCCTTACTCGAGTAAGGCTGTACAATATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-824s21c1
Sequence:CCGGGAAGCAGGCTGTCGATTTATTCTCGAGAATAAATCGACAGCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-639s21c1
Sequence:CCGGATGTTACTTGGAGTGATATAGCTCGAGCTATATCACTCCAAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-456s21c1
Sequence:CCGGTTGGTGCAGTGACATACTTTACTCGAGTAAAGTATGTCACTGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-1102s21c1
Sequence:CCGGGGACCTTGACTCGGCTATAATCTCGAGATTATAGCCGAGTCAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032810.2-2826s21c1
Sequence:CCGGGAATCTGTTAGATCGTTTATTCTCGAGAATAAACGATCTAACAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032810
VALIDATED
ATAD1 MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_032810.2-2460s1c1
Sequence:CCGGGCTGTTACTAAGTGTGCTAAACTCGAGTTTAGCACACTTAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-671s1c1
Sequence:CCGGGATGTCATTACGGATCTGAAACTCGAGTTTCAGATCCGTAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032810.2-481s1c1
Sequence:CCGGCAAATGGATGGTAGATGCAATCTCGAGATTGCATCTACCATCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-1411s1c1
Sequence:CCGGGAAATCAAAGGATGCAGCATTCTCGAGAATGCTGCATCCTTTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032810.2-637s1c1
Sequence:CCGGGCATGTTACTTGGAGTGATATCTCGAGATATCACTCCAAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_032810.2-1709s1c1
Sequence:CCGGGCCATATATTGTACAGCCTTACTCGAGTAAGGCTGTACAATATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-824s21c1
Sequence:CCGGGAAGCAGGCTGTCGATTTATTCTCGAGAATAAATCGACAGCCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-639s21c1
Sequence:CCGGATGTTACTTGGAGTGATATAGCTCGAGCTATATCACTCCAAGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-456s21c1
Sequence:CCGGTTGGTGCAGTGACATACTTTACTCGAGTAAAGTATGTCACTGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032810.2-1102s21c1
Sequence:CCGGGGACCTTGACTCGGCTATAATCTCGAGATTATAGCCGAGTCAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032810.2-2826s21c1
Sequence:CCGGGAATCTGTTAGATCGTTTATTCTCGAGAATAAACGATCTAACAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks