EMAIL THIS PAGE TO A FRIEND

ATAD2

ATPase family, AAA domain containing 2

57 Gene Product Result for
Synonyms: ANCCA PRO2000
Gene ID:
Human(29028) Summary: A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]
Mouse(70472) ATPase family, AAA domain containing 2
Rat(314993) ATPase family, AAA domain containing 2
Zebrafish(335063) ATPase family, AAA domain containing 2
cow(522920) ATPase family, AAA domain containing 2
Horse(100067061) ATPase family, AAA domain containing 2
domestic cat(101083143) ATPase family, AAA domain containing 2
dog(475090) ATPase family, AAA domain containing 2
chicken(420346) ATPase family, AAA domain containing 2
domestic guinea pig(100712635) ATPase family, AAA domain containing 2
naked mole-rat(101719425) ATPase family, AAA domain containing 2
sheep(101103903) ATPase family, AAA domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014109 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014109 Rosetta Predictions human pricing
NM_001134879 Rosetta Predictions rat pricing
NM_027435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176840 predicted 4342
2 SASI_Hs01_00176841 predicted 1957
3 SASI_Hs01_00176842 predicted 3324
4 SASI_Hs01_00176843 predicted 3190
5 SASI_Hs01_00176844 predicted 4273
6 SASI_Hs01_00176846 predicted 3021
7 SASI_Hs01_00176847 predicted 1903
8 SASI_Hs01_00176849 predicted 2871
9 SASI_Hs02_00345116 predicted 1346
10 SASI_Hs02_00345117 predicted 4172
11 SASI_Hs01_00176845 predicted 2820
12 SASI_Hs01_00176848 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258914 predicted 3848
2 SASI_Rn02_00258915 predicted 1582
3 SASI_Rn02_00258916 predicted 3139
4 SASI_Rn02_00258917 predicted 1851
5 SASI_Rn02_00258918 predicted 3770
6 SASI_Rn02_00258919 predicted 2618
7 SASI_Rn02_00258920 predicted 2314
8 SASI_Rn02_00258921 predicted 1969
9 SASI_Rn02_00258922 predicted 4284
10 SASI_Rn02_00258923 predicted 4248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093423 predicted 3438
2 SASI_Mm01_00093424 predicted 4200
3 SASI_Mm01_00093425 predicted 520
4 SASI_Mm01_00093427 predicted 1235
5 SASI_Mm01_00093429 predicted 1178
6 SASI_Mm01_00093430 predicted 4187
7 SASI_Mm01_00093431 predicted 556
8 SASI_Mm01_00093432 predicted 1546
9 SASI_Mm02_00332189 predicted 3082
10 SASI_Mm02_00332190 predicted 463
11 SASI_Mm01_00093426 predicted 3113
12 SASI_Mm01_00093428 predicted 4227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014109
VALIDATED
ATAD2 MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014109.3-581s21c1
Sequence:CCGGGTAGGATTAGAAGTCGTTATACTCGAGTATAACGACTTCTAATCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014109.3-1342s21c1
Sequence:CCGGGCCGATGTTGATCCAATGCAACTCGAGTTGCATTGGATCAACATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014109.3-4345s21c1
Sequence:CCGGGCCTAATTGATGTAGTATGAACTCGAGTTCATACTACATCAATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014109.3-4771s21c1
Sequence:CCGGCCAGAGTGCAAGTCATGATTTCTCGAGAAATCATGACTTGCACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4722s1c1
Sequence:CCGGGCCTTGAGATTCCCTTGTCTTCTCGAGAAGACAAGGGAATCTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-3109s1c1
Sequence:CCGGCGAGTGTTTACTAAGCCTGTTCTCGAGAACAGGCTTAGTAAACACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-1324s1c1
Sequence:CCGGGCCGATGTTGATCCAATGCAACTCGAGTTGCATTGGATCAACATCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4186s1c1
Sequence:CCGGCATCGCAAGGACCATGATAAACTCGAGTTTATCATGGTCCTTGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4753s1c1
Sequence:CCGGCCAGAGTGCAAGTCATGATTTCTCGAGAAATCATGACTTGCACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-563s1c1
Sequence:CCGGGTAGGATTAGAAGTCGTTATACTCGAGTATAACGACTTCTAATCCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4327s1c1
Sequence:CCGGGCCTAATTGATGTAGTATGAACTCGAGTTCATACTACATCAATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4433s1c1
Sequence:CCGGGTCATGTGTAAGATAACTGATCTCGAGATCAGTTATCTTACACATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014109.2-2861s1c1
Sequence:CCGGCGGATAAAGAAGAACGGACAACTCGAGTTGTCCGTTCTTCTTTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014109.2-3646s1c1
Sequence:CCGGGCAAAGGATGATAGCCAGAATCTCGAGATTCTGGCTATCATCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014109
VALIDATED
ATAD2 MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014109.3-581s21c1
Sequence:CCGGGTAGGATTAGAAGTCGTTATACTCGAGTATAACGACTTCTAATCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014109.3-1342s21c1
Sequence:CCGGGCCGATGTTGATCCAATGCAACTCGAGTTGCATTGGATCAACATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014109.3-4345s21c1
Sequence:CCGGGCCTAATTGATGTAGTATGAACTCGAGTTCATACTACATCAATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014109.3-4771s21c1
Sequence:CCGGCCAGAGTGCAAGTCATGATTTCTCGAGAAATCATGACTTGCACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4722s1c1
Sequence:CCGGGCCTTGAGATTCCCTTGTCTTCTCGAGAAGACAAGGGAATCTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-3109s1c1
Sequence:CCGGCGAGTGTTTACTAAGCCTGTTCTCGAGAACAGGCTTAGTAAACACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-1324s1c1
Sequence:CCGGGCCGATGTTGATCCAATGCAACTCGAGTTGCATTGGATCAACATCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4186s1c1
Sequence:CCGGCATCGCAAGGACCATGATAAACTCGAGTTTATCATGGTCCTTGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4753s1c1
Sequence:CCGGCCAGAGTGCAAGTCATGATTTCTCGAGAAATCATGACTTGCACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-563s1c1
Sequence:CCGGGTAGGATTAGAAGTCGTTATACTCGAGTATAACGACTTCTAATCCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4327s1c1
Sequence:CCGGGCCTAATTGATGTAGTATGAACTCGAGTTCATACTACATCAATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4433s1c1
Sequence:CCGGGTCATGTGTAAGATAACTGATCTCGAGATCAGTTATCTTACACATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014109.2-2861s1c1
Sequence:CCGGCGGATAAAGAAGAACGGACAACTCGAGTTGTCCGTTCTTCTTTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014109.2-3646s1c1
Sequence:CCGGGCAAAGGATGATAGCCAGAATCTCGAGATTCTGGCTATCATCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014109
VALIDATED
ATAD2 MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014109.3-581s21c1
Sequence:CCGGGTAGGATTAGAAGTCGTTATACTCGAGTATAACGACTTCTAATCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014109.3-1342s21c1
Sequence:CCGGGCCGATGTTGATCCAATGCAACTCGAGTTGCATTGGATCAACATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014109.3-4345s21c1
Sequence:CCGGGCCTAATTGATGTAGTATGAACTCGAGTTCATACTACATCAATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014109.3-4771s21c1
Sequence:CCGGCCAGAGTGCAAGTCATGATTTCTCGAGAAATCATGACTTGCACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4722s1c1
Sequence:CCGGGCCTTGAGATTCCCTTGTCTTCTCGAGAAGACAAGGGAATCTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-3109s1c1
Sequence:CCGGCGAGTGTTTACTAAGCCTGTTCTCGAGAACAGGCTTAGTAAACACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-1324s1c1
Sequence:CCGGGCCGATGTTGATCCAATGCAACTCGAGTTGCATTGGATCAACATCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4186s1c1
Sequence:CCGGCATCGCAAGGACCATGATAAACTCGAGTTTATCATGGTCCTTGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4753s1c1
Sequence:CCGGCCAGAGTGCAAGTCATGATTTCTCGAGAAATCATGACTTGCACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-563s1c1
Sequence:CCGGGTAGGATTAGAAGTCGTTATACTCGAGTATAACGACTTCTAATCCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4327s1c1
Sequence:CCGGGCCTAATTGATGTAGTATGAACTCGAGTTCATACTACATCAATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014109.2-4433s1c1
Sequence:CCGGGTCATGTGTAAGATAACTGATCTCGAGATCAGTTATCTTACACATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014109.2-2861s1c1
Sequence:CCGGCGGATAAAGAAGAACGGACAACTCGAGTTGTCCGTTCTTCTTTATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014109.2-3646s1c1
Sequence:CCGGGCAAAGGATGATAGCCAGAATCTCGAGATTCTGGCTATCATCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153199
VALIDATED
ATAD2 MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-1787s1c1
Sequence:CCGGGCCTAACTCAAGAGTTTAGATCTCGAGATCTAAACTCTTGAGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-716s1c1
Sequence:CCGGCTTCAATTGTTCCAGATCATACTCGAGTATGATCTGGAACAATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-548s1c1
Sequence:CCGGCCACAAGCAGTTAACAAATATCTCGAGATATTTGTTAACTGCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153199.1-304s1c1
Sequence:CCGGAGAATGAACTTGAAGAGCCTACTCGAGTAGGCTCTTCAAGTTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-546s1c1
Sequence:CCGGGACCACAAGCAGTTAACAAATCTCGAGATTTGTTAACTGCTTGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153199
VALIDATED
ATAD2 MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-1787s1c1
Sequence:CCGGGCCTAACTCAAGAGTTTAGATCTCGAGATCTAAACTCTTGAGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-716s1c1
Sequence:CCGGCTTCAATTGTTCCAGATCATACTCGAGTATGATCTGGAACAATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-548s1c1
Sequence:CCGGCCACAAGCAGTTAACAAATATCTCGAGATATTTGTTAACTGCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153199.1-304s1c1
Sequence:CCGGAGAATGAACTTGAAGAGCCTACTCGAGTAGGCTCTTCAAGTTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-546s1c1
Sequence:CCGGGACCACAAGCAGTTAACAAATCTCGAGATTTGTTAACTGCTTGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153199
VALIDATED
ATAD2 MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-1787s1c1
Sequence:CCGGGCCTAACTCAAGAGTTTAGATCTCGAGATCTAAACTCTTGAGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-716s1c1
Sequence:CCGGCTTCAATTGTTCCAGATCATACTCGAGTATGATCTGGAACAATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-548s1c1
Sequence:CCGGCCACAAGCAGTTAACAAATATCTCGAGATATTTGTTAACTGCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153199.1-304s1c1
Sequence:CCGGAGAATGAACTTGAAGAGCCTACTCGAGTAGGCTCTTCAAGTTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153199.1-546s1c1
Sequence:CCGGGACCACAAGCAGTTAACAAATCTCGAGATTTGTTAACTGCTTGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)