EMAIL THIS PAGE TO A FRIEND

ATAD2B

ATPase family, AAA domain containing 2B

UniProtKB ID: Q9ULI0, B9ZVQ5, Q6ZNA6, Q8N9E7
Gene ID:
Human(54454) Summary: The protein encoded by this gene belongs to the AAA ATPase family, CDC48 subfamily. This subfamily members in eukaryotes are involved in the budding and transfer of membrane from the transitional endoplasmic reticulum to the Golgi apparatus. The exact function of this protein is not known. [provided by RefSeq, May 2011]
Mouse(320817) ATPase family, AAA domain containing 2B
Rat(500625) ATPase family, AAA domain containing 2B
sheep(101105229) ATPase family, AAA domain containing 2B
Domestic Rabbit(100340219) ATPase family, AAA domain containing 2B
naked mole-rat(101724723) ATPase family, AAA domain containing 2B
domestic guinea pig(100717570) ATPase family, AAA domain containing 2B
Zebrafish(100331225) ATPase family, AAA domain containing 2B
cow(518785) ATPase family, AAA domain containing 2B
domestic cat(101098134) ATPase family, AAA domain containing 2B
dog(475681) ATPase family, AAA domain containing 2B
chicken(421972) ATPase family, AAA domain containing 2B
295 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA034555 Anti-ATAD2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_039676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_039676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_039676 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017552 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017552 Rosetta Predictions human pricing
XM_039676 Rosetta Predictions human pricing
XM_931293 Rosetta Predictions human pricing
XM_931301 Rosetta Predictions human pricing
NM_001025151 Rosetta Predictions rat pricing
NM_001040401 Rosetta Predictions mouse pricing
NM_001099628 Rosetta Predictions mouse pricing
XM_001472910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350185 predicted 3679
2 SASI_Hs02_00350186 predicted 4141
3 SASI_Hs02_00350187 predicted 4589
4 SASI_Hs02_00350188 predicted 3286
5 SASI_Hs02_00350189 predicted 2179
6 SASI_Hs02_00350190 predicted 4574
7 SASI_Hs02_00350191 predicted 613
8 SASI_Hs02_00350192 predicted 2520
9 SASI_Hs02_00350193 predicted 4698
10 SASI_Hs02_00350194 predicted 4471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_039676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258873 predicted 3733
2 SASI_Hs01_00258874 predicted 4187
3 SASI_Hs01_00258875 predicted 4637
4 SASI_Hs01_00258876 predicted 3334
5 SASI_Hs01_00258877 predicted 4623
6 SASI_Hs01_00258878 predicted 3292
7 SASI_Hs01_00258879 predicted 663
8 SASI_Hs01_00258880 predicted 4119
9 SASI_Hs01_00258881 predicted 2567
10 SASI_Hs01_00258882 predicted 4746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276534 predicted 2534
2 SASI_Hs01_00276535 predicted 2990
3 SASI_Hs01_00276536 predicted 3443
4 SASI_Hs01_00276537 predicted 2142
5 SASI_Hs01_00276538 predicted 3427
6 SASI_Hs01_00276539 predicted 2093
7 SASI_Hs01_00276540 predicted 2927
8 SASI_Hs01_00276541 predicted 3547
9 SASI_Hs01_00276542 predicted 3314
10 SASI_Hs01_00276543 predicted 2684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257301 predicted 1450
2 SASI_Hs01_00257302 predicted 766
3 SASI_Hs01_00257303 predicted 697
4 SASI_Hs01_00257304 predicted 1450
5 SASI_Hs01_00257305 predicted 1361
6 SASI_Hs01_00257306 predicted 659
7 SASI_Hs01_00257307 predicted 603
8 SASI_Hs01_00257308 predicted 1455
9 SASI_Hs01_00257309 predicted 396
10 SASI_Hs01_00257310 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040955 predicted 994
2 SASI_Rn01_00040956 predicted 642
3 SASI_Rn01_00040957 predicted 832
4 SASI_Rn01_00040958 predicted 616
5 SASI_Rn01_00040959 predicted 732
6 SASI_Rn01_00040960 predicted 885
7 SASI_Rn02_00203078 predicted 715
8 SASI_Rn01_00040962 predicted 502
9 SASI_Rn01_00040963 predicted 671
10 SASI_Rn01_00040964 predicted 1513
11 SASI_Rn01_00040961 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078731 predicted 1152
2 SASI_Mm01_00078732 predicted 1382
3 SASI_Mm01_00078733 predicted 1557
4 SASI_Mm01_00078734 predicted 1588
5 SASI_Mm01_00078735 predicted 1206
6 SASI_Mm01_00078736 predicted 1593
7 SASI_Mm01_00078737 predicted 990
8 SASI_Mm01_00078738 predicted 1378
9 SASI_Mm01_00078739 predicted 1028
10 SASI_Mm01_00078740 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301845 predicted 667
2 SASI_Mm02_00301846 predicted 3748
3 SASI_Mm02_00301847 predicted 4149
4 SASI_Mm02_00301848 predicted 1941
5 SASI_Mm02_00301849 predicted 1028
6 SASI_Mm02_00301850 predicted 2912
7 SASI_Mm02_00301851 predicted 1417
8 SASI_Mm02_00301852 predicted 4218
9 SASI_Mm02_00301853 predicted 3398
10 SASI_Mm02_00301854 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00364631 predicted 671
2 SASI_Mm02_00364632 predicted 3752
3 SASI_Mm02_00364633 predicted 4150
4 SASI_Mm02_00364634 predicted 1943
5 SASI_Mm02_00364635 predicted 1034
6 SASI_Mm02_00364636 predicted 2914
7 SASI_Mm02_00364637 predicted 1417
8 SASI_Mm02_00364638 predicted 4217
9 SASI_Mm02_00364639 predicted 3400
10 SASI_Mm02_00364640 predicted 1876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177269
VALIDATED
ATAD2B MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 2B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177269.2-1389s1c1
Sequence:CCGGCCGATGAACTTCAGAGCAGAACTCGAGTTCTGCTCTGAAGTTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-1086s1c1
Sequence:CCGGGAAGAATCTCAAGAGGAGGATCTCGAGATCCTCCTCTTGAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-1028s1c1
Sequence:CCGGGAGAAGAAATAGTTATGGGATCTCGAGATCCCATAACTATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177269.2-941s1c1
Sequence:CCGGCGAAGTAGAGAGGCTTCGAATCTCGAGATTCGAAGCCTCTCTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177269.2-1582s1c1
Sequence:CCGGCTCAGATATGACCAGTATTAACTCGAGTTAATACTGGTCATATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-958s1c1
Sequence:CCGGGAATGTGGACAGATACAGAATCTCGAGATTCTGTATCTGTCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177269.2-1104s1c1
Sequence:CCGGGATGGAGACATAGAGGTTGAACTCGAGTTCAACCTCTATGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177269
VALIDATED
ATAD2B MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 2B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177269.2-1389s1c1
Sequence:CCGGCCGATGAACTTCAGAGCAGAACTCGAGTTCTGCTCTGAAGTTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-1086s1c1
Sequence:CCGGGAAGAATCTCAAGAGGAGGATCTCGAGATCCTCCTCTTGAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-1028s1c1
Sequence:CCGGGAGAAGAAATAGTTATGGGATCTCGAGATCCCATAACTATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177269.2-941s1c1
Sequence:CCGGCGAAGTAGAGAGGCTTCGAATCTCGAGATTCGAAGCCTCTCTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177269.2-1582s1c1
Sequence:CCGGCTCAGATATGACCAGTATTAACTCGAGTTAATACTGGTCATATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-958s1c1
Sequence:CCGGGAATGTGGACAGATACAGAATCTCGAGATTCTGTATCTGTCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177269.2-1104s1c1
Sequence:CCGGGATGGAGACATAGAGGTTGAACTCGAGTTCAACCTCTATGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177269
VALIDATED
ATAD2B MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 2B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177269.2-1389s1c1
Sequence:CCGGCCGATGAACTTCAGAGCAGAACTCGAGTTCTGCTCTGAAGTTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-1086s1c1
Sequence:CCGGGAAGAATCTCAAGAGGAGGATCTCGAGATCCTCCTCTTGAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-1028s1c1
Sequence:CCGGGAGAAGAAATAGTTATGGGATCTCGAGATCCCATAACTATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177269.2-941s1c1
Sequence:CCGGCGAAGTAGAGAGGCTTCGAATCTCGAGATTCGAAGCCTCTCTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177269.2-1582s1c1
Sequence:CCGGCTCAGATATGACCAGTATTAACTCGAGTTAATACTGGTCATATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177269.2-958s1c1
Sequence:CCGGGAATGTGGACAGATACAGAATCTCGAGATTCTGTATCTGTCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_177269.2-1104s1c1
Sequence:CCGGGATGGAGACATAGAGGTTGAACTCGAGTTCAACCTCTATGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_039676
VALIDATED
ATAD2B MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-1603s1c1
Sequence:CCGGGCCATCATATTCATGCGCTAACTCGAGTTAGCGCATGAATATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_039676.5-3455s1c1
Sequence:CCGGCCTCATCTGTAGCAATGCTTTCTCGAGAAAGCATTGCTACAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_039676.5-1318s1c1
Sequence:CCGGCGCTGTTTGATATTCATAGATCTCGAGATCTATGAATATCAAACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-3342s1c1
Sequence:CCGGCCGGTTTCAGATTATCTTGAACTCGAGTTCAAGATAATCTGAAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-4371s1c1
Sequence:CCGGGCACTGGAATGTAGCAATAATCTCGAGATTATTGCTACATTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_039676
VALIDATED
ATAD2B MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-1603s1c1
Sequence:CCGGGCCATCATATTCATGCGCTAACTCGAGTTAGCGCATGAATATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_039676.5-3455s1c1
Sequence:CCGGCCTCATCTGTAGCAATGCTTTCTCGAGAAAGCATTGCTACAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_039676.5-1318s1c1
Sequence:CCGGCGCTGTTTGATATTCATAGATCTCGAGATCTATGAATATCAAACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-3342s1c1
Sequence:CCGGCCGGTTTCAGATTATCTTGAACTCGAGTTCAAGATAATCTGAAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-4371s1c1
Sequence:CCGGGCACTGGAATGTAGCAATAATCTCGAGATTATTGCTACATTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_039676
VALIDATED
ATAD2B MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-1603s1c1
Sequence:CCGGGCCATCATATTCATGCGCTAACTCGAGTTAGCGCATGAATATGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_039676.5-3455s1c1
Sequence:CCGGCCTCATCTGTAGCAATGCTTTCTCGAGAAAGCATTGCTACAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_039676.5-1318s1c1
Sequence:CCGGCGCTGTTTGATATTCATAGATCTCGAGATCTATGAATATCAAACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-3342s1c1
Sequence:CCGGCCGGTTTCAGATTATCTTGAACTCGAGTTCAAGATAATCTGAAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_039676.5-4371s1c1
Sequence:CCGGGCACTGGAATGTAGCAATAATCTCGAGATTATTGCTACATTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099628
VALIDATED
ATAD2B MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 2B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099628.1-5238s21c1
Sequence:CCGGTAGAATTGGCTATGGTGTATTCTCGAGAATACACCATAGCCAATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001099628.1-7896s1c1
Sequence:CCGGCTTCATCAACTATGGTCTATTCTCGAGAATAGACCATAGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001099628.1-1946s1c1
Sequence:CCGGCCTTATGGATGGATTAGATAACTCGAGTTATCTAATCCATCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-1820s21c1
Sequence:CCGGGCTCTTTGATCAGGCATATTTCTCGAGAAATATGCCTGATCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-2832s21c1
Sequence:CCGGCGAAGAACAGTACCGAGTATTCTCGAGAATACTCGGTACTGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-1947s21c1
Sequence:CCGGCTTATGGATGGATTAGATAATCTCGAGATTATCTAATCCATCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001099628.1-1561s21c1
Sequence:CCGGGTGGATTGAGCCATCATATTCCTCGAGGAATATGATGGCTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099628
VALIDATED
ATAD2B MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 2B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099628.1-5238s21c1
Sequence:CCGGTAGAATTGGCTATGGTGTATTCTCGAGAATACACCATAGCCAATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001099628.1-7896s1c1
Sequence:CCGGCTTCATCAACTATGGTCTATTCTCGAGAATAGACCATAGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001099628.1-1946s1c1
Sequence:CCGGCCTTATGGATGGATTAGATAACTCGAGTTATCTAATCCATCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-1820s21c1
Sequence:CCGGGCTCTTTGATCAGGCATATTTCTCGAGAAATATGCCTGATCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-2832s21c1
Sequence:CCGGCGAAGAACAGTACCGAGTATTCTCGAGAATACTCGGTACTGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-1947s21c1
Sequence:CCGGCTTATGGATGGATTAGATAATCTCGAGATTATCTAATCCATCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001099628.1-1561s21c1
Sequence:CCGGGTGGATTGAGCCATCATATTCCTCGAGGAATATGATGGCTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099628
VALIDATED
ATAD2B MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 2B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099628.1-5238s21c1
Sequence:CCGGTAGAATTGGCTATGGTGTATTCTCGAGAATACACCATAGCCAATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001099628.1-7896s1c1
Sequence:CCGGCTTCATCAACTATGGTCTATTCTCGAGAATAGACCATAGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001099628.1-1946s1c1
Sequence:CCGGCCTTATGGATGGATTAGATAACTCGAGTTATCTAATCCATCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-1820s21c1
Sequence:CCGGGCTCTTTGATCAGGCATATTTCTCGAGAAATATGCCTGATCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-2832s21c1
Sequence:CCGGCGAAGAACAGTACCGAGTATTCTCGAGAATACTCGGTACTGTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099628.1-1947s21c1
Sequence:CCGGCTTATGGATGGATTAGATAATCTCGAGATTATCTAATCCATCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001099628.1-1561s21c1
Sequence:CCGGGTGGATTGAGCCATCATATTCCTCGAGGAATATGATGGCTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017552
ATAD2B MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017552.1-4737s21c1
Sequence:CCGGCAATTTCAAATTGCACCAATTCTCGAGAATTGGTGCAATTTGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-514s21c1
Sequence:CCGGGTTGAAGTTGATGGTAGTTTACTCGAGTAAACTACCATCAACTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1502s21c1
Sequence:CCGGGTGGATTGAGCCATCATATTCCTCGAGGAATATGATGGCTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1527s21c1
Sequence:CCGGGCTAAAGGAAATGGTAGTATTCTCGAGAATACTACCATTTCCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1887s21c1
Sequence:CCGGTCTTATGGATGGATTAGATAACTCGAGTTATCTAATCCATCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017552
ATAD2B MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017552.1-4737s21c1
Sequence:CCGGCAATTTCAAATTGCACCAATTCTCGAGAATTGGTGCAATTTGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-514s21c1
Sequence:CCGGGTTGAAGTTGATGGTAGTTTACTCGAGTAAACTACCATCAACTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1502s21c1
Sequence:CCGGGTGGATTGAGCCATCATATTCCTCGAGGAATATGATGGCTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1527s21c1
Sequence:CCGGGCTAAAGGAAATGGTAGTATTCTCGAGAATACTACCATTTCCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1887s21c1
Sequence:CCGGTCTTATGGATGGATTAGATAACTCGAGTTATCTAATCCATCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017552
ATAD2B MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017552.1-4737s21c1
Sequence:CCGGCAATTTCAAATTGCACCAATTCTCGAGAATTGGTGCAATTTGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-514s21c1
Sequence:CCGGGTTGAAGTTGATGGTAGTTTACTCGAGTAAACTACCATCAACTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1502s21c1
Sequence:CCGGGTGGATTGAGCCATCATATTCCTCGAGGAATATGATGGCTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1527s21c1
Sequence:CCGGGCTAAAGGAAATGGTAGTATTCTCGAGAATACTACCATTTCCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017552.1-1887s21c1
Sequence:CCGGTCTTATGGATGGATTAGATAACTCGAGTTATCTAATCCATCCATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks