EMAIL THIS PAGE TO A FRIEND

ATAD3A

ATPase family, AAA domain containing 3A

43 Gene Product Result for
Gene ID:
Human(55210) Summary: ATAD3A and ATAD3B (MIM 612317) are mitochondrial membrane proteins that contribute to the stabilization of large mitochondrial DNA (mtDNA)-protein complexes called nucleoids (He et al., 2007 [PubMed 17210950]
Mouse(108888) ATPase family, AAA domain containing 3A
Rat(298682) ATPase family, AAA domain containing 3A
chicken(419412) ATPase family, AAA domain containing 3A
cow(784353) ATPase family, AAA domain containing 3A
naked mole-rat(101709814) ATPase family, AAA domain containing 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_179203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_179203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_179203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018188 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068931 MISSION® esiRNA esiRNA targeting mouse Atad3a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018188 Rosetta Predictions human pricing
NM_001034922 Rosetta Predictions rat pricing
NM_179203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028937 predicted 1034
2 SASI_Hs01_00028938 predicted 1988
3 SASI_Hs01_00028939 predicted 1607
4 SASI_Hs01_00028940 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102075 predicted 264
2 SASI_Rn01_00102076 predicted 1121
3 SASI_Rn01_00102077 predicted 653
4 SASI_Rn01_00102078 predicted 1558
5 SASI_Rn01_00102079 predicted 654
6 SASI_Rn01_00102081 predicted 457
7 SASI_Rn02_00204062 predicted 815
8 SASI_Rn01_00102082 predicted 807
9 SASI_Rn01_00102083 predicted 1337
10 SASI_Rn01_00102084 predicted 1424
11 SASI_Rn01_00102080 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_179203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349576 predicted 1411
2 SASI_Mm01_00098173 predicted 1453
3 SASI_Mm01_00098174 predicted 1062
4 SASI_Mm01_00098176 predicted 887
5 SASI_Mm01_00098177 predicted 1466
6 SASI_Mm01_00098178 predicted 1019
7 SASI_Mm01_00098179 predicted 843
8 SASI_Mm01_00098180 predicted 1558
9 SASI_Mm01_00098181 predicted 686
10 SASI_Mm01_00098182 predicted 1168
11 SASI_Mm01_00098175 predicted 1788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_179203
ATAD3A MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 3A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-855s21c1
Sequence:CCGGATTAGCTGTTGGAGTCTATTCCTCGAGGAATAGACTCCAACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_179203.2-2231s21c1
Sequence:CCGGGGACATTACTCCTACCATATACTCGAGTATATGGTAGGAGTAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-892s21c1
Sequence:CCGGTCTGTTGCTGGTCGGTATATTCTCGAGAATATACCGACCAGCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-787s21c1
Sequence:CCGGGGTGAAGGATTCCGTGCATTTCTCGAGAAATGCACGGAATCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-1151s21c1
Sequence:CCGGGGACTGGCAAGACACTATTTGCTCGAGCAAATAGTGTCTTGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_179203.1-1459s1c1
Sequence:CCGGGCAGTTTGATTGGGCTATCAACTCGAGTTGATAGCCCAATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_179203.1-1534s1c1
Sequence:CCGGGCGCCTGGTGAGAATGTATTTCTCGAGAAATACATTCTCACCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_179203.1-1951s1c1
Sequence:CCGGCCTCTGTAAGAGGTCAACATTCTCGAGAATGTTGACCTCTTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_179203
ATAD3A MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 3A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-855s21c1
Sequence:CCGGATTAGCTGTTGGAGTCTATTCCTCGAGGAATAGACTCCAACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_179203.2-2231s21c1
Sequence:CCGGGGACATTACTCCTACCATATACTCGAGTATATGGTAGGAGTAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-892s21c1
Sequence:CCGGTCTGTTGCTGGTCGGTATATTCTCGAGAATATACCGACCAGCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-787s21c1
Sequence:CCGGGGTGAAGGATTCCGTGCATTTCTCGAGAAATGCACGGAATCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-1151s21c1
Sequence:CCGGGGACTGGCAAGACACTATTTGCTCGAGCAAATAGTGTCTTGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_179203.1-1459s1c1
Sequence:CCGGGCAGTTTGATTGGGCTATCAACTCGAGTTGATAGCCCAATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_179203.1-1534s1c1
Sequence:CCGGGCGCCTGGTGAGAATGTATTTCTCGAGAAATACATTCTCACCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_179203.1-1951s1c1
Sequence:CCGGCCTCTGTAAGAGGTCAACATTCTCGAGAATGTTGACCTCTTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_179203
ATAD3A MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 3A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-855s21c1
Sequence:CCGGATTAGCTGTTGGAGTCTATTCCTCGAGGAATAGACTCCAACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_179203.2-2231s21c1
Sequence:CCGGGGACATTACTCCTACCATATACTCGAGTATATGGTAGGAGTAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-892s21c1
Sequence:CCGGTCTGTTGCTGGTCGGTATATTCTCGAGAATATACCGACCAGCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-787s21c1
Sequence:CCGGGGTGAAGGATTCCGTGCATTTCTCGAGAAATGCACGGAATCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_179203.2-1151s21c1
Sequence:CCGGGGACTGGCAAGACACTATTTGCTCGAGCAAATAGTGTCTTGCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_179203.1-1459s1c1
Sequence:CCGGGCAGTTTGATTGGGCTATCAACTCGAGTTGATAGCCCAATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_179203.1-1534s1c1
Sequence:CCGGGCGCCTGGTGAGAATGTATTTCTCGAGAAATACATTCTCACCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190902    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_179203.1-1951s1c1
Sequence:CCGGCCTCTGTAAGAGGTCAACATTCTCGAGAATGTTGACCTCTTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018188
VALIDATED
ATAD3A MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 3A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1636s21c1
Sequence:CCGGCATCAATGAGATGGTCCACTTCTCGAGAAGTGGACCATCTCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-2347s21c1
Sequence:CCGGGCCAGGCAGGTGATGTCTTTGCTCGAGCAAAGACATCACCTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1993s21c1
Sequence:CCGGATCCTGAGTCCACAGGGAGATCTCGAGATCTCCCTGTGGACTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1595s21c1
Sequence:CCGGAGCAACCAACCAGAGCAGTTCCTCGAGGAACTGCTCTGGTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018188.2-509s21c1
Sequence:CCGGTGTGCTCTGCAGGAGTATGAGCTCGAGCTCATACTCCTGCAGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018188.2-222s1c1
Sequence:CCGGCCAAGGACAAATGGAGCAACTCTCGAGAGTTGCTCCATTTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018188.2-955s1c1
Sequence:CCGGCTTTGTGACAGACTGGGACAACTCGAGTTGTCCCAGTCTGTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-223s1c1
Sequence:CCGGCAAGGACAAATGGAGCAACTTCTCGAGAAGTTGCTCCATTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_018188.2-1234s1c1
Sequence:CCGGCATAGCAACAAGGAACACCAACTCGAGTTGGTGTTCCTTGTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-683s1c1
Sequence:CCGGCAACTTCTCAATGAGGAGAATCTCGAGATTCTCCTCATTGAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-2067s1c1
Sequence:CCGGCCTGCACATTTAGGATATGCTCTCGAGAGCATATCCTAAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018188.2-1233s1c1
Sequence:CCGGCCATAGCAACAAGGAACACCACTCGAGTGGTGTTCCTTGTTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018188
VALIDATED
ATAD3A MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 3A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1636s21c1
Sequence:CCGGCATCAATGAGATGGTCCACTTCTCGAGAAGTGGACCATCTCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-2347s21c1
Sequence:CCGGGCCAGGCAGGTGATGTCTTTGCTCGAGCAAAGACATCACCTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1993s21c1
Sequence:CCGGATCCTGAGTCCACAGGGAGATCTCGAGATCTCCCTGTGGACTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1595s21c1
Sequence:CCGGAGCAACCAACCAGAGCAGTTCCTCGAGGAACTGCTCTGGTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018188.2-509s21c1
Sequence:CCGGTGTGCTCTGCAGGAGTATGAGCTCGAGCTCATACTCCTGCAGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018188.2-222s1c1
Sequence:CCGGCCAAGGACAAATGGAGCAACTCTCGAGAGTTGCTCCATTTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018188.2-955s1c1
Sequence:CCGGCTTTGTGACAGACTGGGACAACTCGAGTTGTCCCAGTCTGTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-223s1c1
Sequence:CCGGCAAGGACAAATGGAGCAACTTCTCGAGAAGTTGCTCCATTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_018188.2-1234s1c1
Sequence:CCGGCATAGCAACAAGGAACACCAACTCGAGTTGGTGTTCCTTGTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-683s1c1
Sequence:CCGGCAACTTCTCAATGAGGAGAATCTCGAGATTCTCCTCATTGAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-2067s1c1
Sequence:CCGGCCTGCACATTTAGGATATGCTCTCGAGAGCATATCCTAAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018188.2-1233s1c1
Sequence:CCGGCCATAGCAACAAGGAACACCACTCGAGTGGTGTTCCTTGTTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018188
VALIDATED
ATAD3A MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 3A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1636s21c1
Sequence:CCGGCATCAATGAGATGGTCCACTTCTCGAGAAGTGGACCATCTCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-2347s21c1
Sequence:CCGGGCCAGGCAGGTGATGTCTTTGCTCGAGCAAAGACATCACCTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1993s21c1
Sequence:CCGGATCCTGAGTCCACAGGGAGATCTCGAGATCTCCCTGTGGACTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018188.2-1595s21c1
Sequence:CCGGAGCAACCAACCAGAGCAGTTCCTCGAGGAACTGCTCTGGTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018188.2-509s21c1
Sequence:CCGGTGTGCTCTGCAGGAGTATGAGCTCGAGCTCATACTCCTGCAGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018188.2-222s1c1
Sequence:CCGGCCAAGGACAAATGGAGCAACTCTCGAGAGTTGCTCCATTTGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018188.2-955s1c1
Sequence:CCGGCTTTGTGACAGACTGGGACAACTCGAGTTGTCCCAGTCTGTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-223s1c1
Sequence:CCGGCAAGGACAAATGGAGCAACTTCTCGAGAAGTTGCTCCATTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_018188.2-1234s1c1
Sequence:CCGGCATAGCAACAAGGAACACCAACTCGAGTTGGTGTTCCTTGTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-683s1c1
Sequence:CCGGCAACTTCTCAATGAGGAGAATCTCGAGATTCTCCTCATTGAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018188.2-2067s1c1
Sequence:CCGGCCTGCACATTTAGGATATGCTCTCGAGAGCATATCCTAAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018188.2-1233s1c1
Sequence:CCGGCCATAGCAACAAGGAACACCACTCGAGTGGTGTTCCTTGTTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks