EMAIL THIS PAGE TO A FRIEND

ATAD3B

ATPase family, AAA domain containing 3B

18 Gene Product Result for
Synonyms: AAA-TOB3 TOB3
UniProtKB ID: Q5T9A4, A8K3H1, Q6ZRB5, Q9BUK4, Q9ULE7
Gene ID:
Human(83858) Summary: ATAD3A (MIM 612316) and ATAD3B are mitochondrial membrane proteins that contribute to the stabilization of large mitochondrial DNA (mtDNA)-protein complexes called nucleoids (He et al., 2007 [PubMed 17210950]
Zebrafish(403004) ATPase family, AAA domain containing 3B
dog(479568) ATPase family AAA domain-containing protein 3-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031921 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128081 MISSION® esiRNA esiRNA human ATAD3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031921 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070873 predicted 1420
2 SASI_Hs01_00070874 predicted 1358
3 SASI_Hs01_00070875 predicted 883
4 SASI_Hs01_00070876 predicted 1778
5 SASI_Hs01_00070877 predicted 1369
6 SASI_Hs01_00070879 predicted 1860
7 SASI_Hs01_00070880 predicted 2390
8 SASI_Hs01_00070881 predicted 2396
9 SASI_Hs01_00070882 predicted 360
10 SASI_Hs01_00070878 predicted 1801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031921
VALIDATED
ATAD3B MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 3B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031921.3-185s1c1
Sequence:CCGGCAAGGACAAATGGAGCAACTTCTCGAGAAGTTGCTCCATTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-324s1c1
Sequence:CCGGCAGTCCAAGCTCAAAGAGTATCTCGAGATACTCTTTGAGCTTGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-509s1c1
Sequence:CCGGCAATGAGGAGAATTTACGGAACTCGAGTTCCGTAAATTCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-1885s1c1
Sequence:CCGGCCTGCACATTTAGGATATGCTCTCGAGAGCATATCCTAAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031921.3-1891s1c1
Sequence:CCGGCATTTAGGATATGCTCCTGGACTCGAGTCCAGGAGCATATCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-370s21c1
Sequence:CCGGAGTCCAAGCTCAAAGAGTATGCTCGAGCATACTCTTTGAGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1357s21c1
Sequence:CCGGAGCGAGCCACTGAGGAGATAACTCGAGTTATCTCCTCAGTGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1566s21c1
Sequence:CCGGTTTGACAACTGTGTTCTTAAGCTCGAGCTTAAGAACACAGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031921.4-2091s21c1
Sequence:CCGGACACTCTTGGGAGATGCATTTCTCGAGAAATGCATCTCCCAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1484s21c1
Sequence:CCGGTGCCATCAACAGCCGCATTGACTCGAGTCAATGCGGCTGTTGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031921
VALIDATED
ATAD3B MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 3B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031921.3-185s1c1
Sequence:CCGGCAAGGACAAATGGAGCAACTTCTCGAGAAGTTGCTCCATTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-324s1c1
Sequence:CCGGCAGTCCAAGCTCAAAGAGTATCTCGAGATACTCTTTGAGCTTGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-509s1c1
Sequence:CCGGCAATGAGGAGAATTTACGGAACTCGAGTTCCGTAAATTCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-1885s1c1
Sequence:CCGGCCTGCACATTTAGGATATGCTCTCGAGAGCATATCCTAAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031921.3-1891s1c1
Sequence:CCGGCATTTAGGATATGCTCCTGGACTCGAGTCCAGGAGCATATCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-370s21c1
Sequence:CCGGAGTCCAAGCTCAAAGAGTATGCTCGAGCATACTCTTTGAGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1357s21c1
Sequence:CCGGAGCGAGCCACTGAGGAGATAACTCGAGTTATCTCCTCAGTGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1566s21c1
Sequence:CCGGTTTGACAACTGTGTTCTTAAGCTCGAGCTTAAGAACACAGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031921.4-2091s21c1
Sequence:CCGGACACTCTTGGGAGATGCATTTCTCGAGAAATGCATCTCCCAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1484s21c1
Sequence:CCGGTGCCATCAACAGCCGCATTGACTCGAGTCAATGCGGCTGTTGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031921
VALIDATED
ATAD3B MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 3B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031921.3-185s1c1
Sequence:CCGGCAAGGACAAATGGAGCAACTTCTCGAGAAGTTGCTCCATTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-324s1c1
Sequence:CCGGCAGTCCAAGCTCAAAGAGTATCTCGAGATACTCTTTGAGCTTGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-509s1c1
Sequence:CCGGCAATGAGGAGAATTTACGGAACTCGAGTTCCGTAAATTCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_031921.3-1885s1c1
Sequence:CCGGCCTGCACATTTAGGATATGCTCTCGAGAGCATATCCTAAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031921.3-1891s1c1
Sequence:CCGGCATTTAGGATATGCTCCTGGACTCGAGTCCAGGAGCATATCCTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-370s21c1
Sequence:CCGGAGTCCAAGCTCAAAGAGTATGCTCGAGCATACTCTTTGAGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1357s21c1
Sequence:CCGGAGCGAGCCACTGAGGAGATAACTCGAGTTATCTCCTCAGTGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1566s21c1
Sequence:CCGGTTTGACAACTGTGTTCTTAAGCTCGAGCTTAAGAACACAGTTGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031921.4-2091s21c1
Sequence:CCGGACACTCTTGGGAGATGCATTTCTCGAGAAATGCATCTCCCAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031921.4-1484s21c1
Sequence:CCGGTGCCATCAACAGCCGCATTGACTCGAGTCAATGCGGCTGTTGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks