EMAIL THIS PAGE TO A FRIEND

ATAD3C

ATPase family, AAA domain containing 3C

124 Gene Product Result for
Species: Human ATAD3C(219293)
UniProtKB ID: Q5T2N8, Q8N1Z5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305852 ANTI-ATAD3C (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198466 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039211 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180377 predicted 300
2 SASI_Hs01_00180378 predicted 291
3 SASI_Hs01_00180379 predicted 296
4 SASI_Hs01_00180380 predicted 391
5 SASI_Hs01_00180381 predicted 293
6 SASI_Hs01_00180382 predicted 303
7 SASI_Hs01_00180383 predicted 298
8 SASI_Hs01_00180384 predicted 295
9 SASI_Hs01_00180385 predicted 247
10 SASI_Hs01_00180386 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039211
ATAD3C MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 3C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-2141s21c1
Sequence:CCGGCGTGCAAGACTTTGTCCAGCACTCGAGTGCTGGACAAAGTCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-1453s21c1
Sequence:CCGGTGCGCGACATCGCCATAATGACTCGAGTCATTATGGCGATGTCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039211.2-3137s21c1
Sequence:CCGGAGTGAGACTGTACCTCTAAATCTCGAGATTTAGAGGTACAGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-1461s21c1
Sequence:CCGGATCGCCATAATGACAAGGAACCTCGAGGTTCCTTGTCATTATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-2217s21c1
Sequence:CCGGCAACCCTCATCCTGAGTCCATCTCGAGATGGACTCAGGATGAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039211
ATAD3C MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 3C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-2141s21c1
Sequence:CCGGCGTGCAAGACTTTGTCCAGCACTCGAGTGCTGGACAAAGTCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-1453s21c1
Sequence:CCGGTGCGCGACATCGCCATAATGACTCGAGTCATTATGGCGATGTCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039211.2-3137s21c1
Sequence:CCGGAGTGAGACTGTACCTCTAAATCTCGAGATTTAGAGGTACAGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-1461s21c1
Sequence:CCGGATCGCCATAATGACAAGGAACCTCGAGGTTCCTTGTCATTATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-2217s21c1
Sequence:CCGGCAACCCTCATCCTGAGTCCATCTCGAGATGGACTCAGGATGAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039211
ATAD3C MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 3C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-2141s21c1
Sequence:CCGGCGTGCAAGACTTTGTCCAGCACTCGAGTGCTGGACAAAGTCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-1453s21c1
Sequence:CCGGTGCGCGACATCGCCATAATGACTCGAGTCATTATGGCGATGTCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039211.2-3137s21c1
Sequence:CCGGAGTGAGACTGTACCTCTAAATCTCGAGATTTAGAGGTACAGTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-1461s21c1
Sequence:CCGGATCGCCATAATGACAAGGAACCTCGAGGTTCCTTGTCATTATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039211.2-2217s21c1
Sequence:CCGGCAACCCTCATCCTGAGTCCATCTCGAGATGGACTCAGGATGAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198466
ATAD3C MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 3C
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000179996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198466.1-1477s1c1
Sequence:CCGGCCTGCACTTATACATCCAGATCTCGAGATCTGGATGTATAAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198466
ATAD3C MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 3C
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000179996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198466.1-1477s1c1
Sequence:CCGGCCTGCACTTATACATCCAGATCTCGAGATCTGGATGTATAAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198466
ATAD3C MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 3C
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000179996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198466.1-1477s1c1
Sequence:CCGGCCTGCACTTATACATCCAGATCTCGAGATCTGGATGTATAAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks