EMAIL THIS PAGE TO A FRIEND

ATAD5

ATPase family, AAA domain containing 5

128 Gene Product Result for
Synonyms: C17orf41 ELG1 FRAG1
UniProtKB ID: Q96QE3, Q05DH0, Q69YR6, Q9H9I1
Gene ID:
Mouse(237877) ATPase family, AAA domain containing 5
Rat(303348) ATPase family, AAA domain containing 5
chicken(417408) ATPase family, AAA domain containing 5
dog(491156) ATPase family, AAA domain containing 5
Horse(100058527) ATPase family, AAA domain containing 5
cow(513059) ATPase family, AAA domain containing 5
domestic cat(101093407) ATPase family, AAA domain containing 5
naked mole-rat(101719734) ATPase family, AAA domain containing 5
domestic guinea pig(100720342) ATPase family, AAA domain containing 5
sheep(101122447) ATPase family, AAA domain containing 5
Domestic Rabbit(100350844) ATPase family, AAA domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301194 Anti-ATAD5 antibody produced in rabbit affinity isolated antibody human
western blot pricing
PLA0164 Rabbit anti-ATAD5/FRAG1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, chimpanzee, gibbon, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024857 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024857 Rosetta Predictions human pricing
XM_001080963 Rosetta Predictions rat pricing
XM_220750 Rosetta Predictions rat pricing
NM_001029856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357436 predicted 4487
2 SASI_Hs01_00158474 predicted 1191
3 SASI_Hs01_00158475 predicted 5795
4 SASI_Hs02_00357437 predicted 4626
5 SASI_Hs02_00357438 predicted 1719
6 SASI_Hs01_00158477 predicted 1469
7 SASI_Hs01_00158478 predicted 5412
8 SASI_Hs01_00158479 predicted 4343
9 SASI_Hs01_00158480 predicted 5556
10 SASI_Hs01_00158481 predicted 5737
11 SASI_Hs01_00158476 predicted 400
12 SASI_Hs01_00158482 predicted 1961
13 SASI_Hs01_00158483 predicted 3078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370044 predicted 3851
2 SASI_Rn02_00370045 predicted 2671
3 SASI_Rn02_00370046 predicted 4042
4 SASI_Rn02_00370047 predicted 1761
5 SASI_Rn02_00370048 predicted 4754
6 SASI_Rn02_00370049 predicted 1027
7 SASI_Rn02_00370050 predicted 1373
8 SASI_Rn02_00370051 predicted 5495
9 SASI_Rn02_00370052 predicted 4112
10 SASI_Rn02_00370053 predicted 4952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379513 predicted 3845
2 SASI_Rn02_00379514 predicted 2671
3 SASI_Rn02_00379515 predicted 4040
4 SASI_Rn02_00379516 predicted 1765
5 SASI_Rn02_00379517 predicted 4762
6 SASI_Rn02_00379518 predicted 1373
7 SASI_Rn02_00379519 predicted 5496
8 SASI_Rn02_00379520 predicted 4116
9 SASI_Rn02_00379521 predicted 4951
10 SASI_Rn02_00379522 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074893 predicted 4323
2 SASI_Mm01_00074895 predicted 2867
3 SASI_Mm02_00288034 predicted 1120
4 SASI_Mm02_00288035 predicted 2080
5 SASI_Mm01_00074897 predicted 740
6 SASI_Mm02_00288036 predicted 5586
7 SASI_Mm01_00074900 predicted 4308
8 SASI_Mm01_00074901 predicted 4567
9 SASI_Mm01_00074902 predicted 2065
10 SASI_Mm02_00288037 predicted 5343
11 SASI_Mm01_00074894 predicted 5615
12 SASI_Mm01_00074896 predicted 2103
13 SASI_Mm01_00074898 predicted 5317
14 SASI_Mm01_00074899 predicted 4414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029856
VALIDATED
ATAD5 MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029856.1-6206s1c1
Sequence:CCGGGCAGTCTCTAAAGTTACACAACTCGAGTTGTGTAACTTTAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029856.1-5712s1c1
Sequence:CCGGCGGAACATTTGTCGGACAGAACTCGAGTTCTGTCCGACAAATGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029856.1-4341s1c1
Sequence:CCGGCCCACATTTAGTCTAGTGTTTCTCGAGAAACACTAGACTAAATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-6693s21c1
Sequence:CCGGATGTCTTGTATCCTAGTATATCTCGAGATATACTAGGATACAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029856.2-3652s21c1
Sequence:CCGGTATCGGATAGCACGGACTTTACTCGAGTAAAGTCCGTGCTATCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-4144s21c1
Sequence:CCGGGGCAACTTATTCAGACTAAATCTCGAGATTTAGTCTGAATAAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-1477s21c1
Sequence:CCGGTGATCCAGGAGGGCCAATTAGCTCGAGCTAATTGGCCCTCCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029856.2-4314s21c1
Sequence:CCGGACAACTAAACGACCAGTAATTCTCGAGAATTACTGGTCGTTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029856
VALIDATED
ATAD5 MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029856.1-6206s1c1
Sequence:CCGGGCAGTCTCTAAAGTTACACAACTCGAGTTGTGTAACTTTAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029856.1-5712s1c1
Sequence:CCGGCGGAACATTTGTCGGACAGAACTCGAGTTCTGTCCGACAAATGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029856.1-4341s1c1
Sequence:CCGGCCCACATTTAGTCTAGTGTTTCTCGAGAAACACTAGACTAAATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-6693s21c1
Sequence:CCGGATGTCTTGTATCCTAGTATATCTCGAGATATACTAGGATACAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029856.2-3652s21c1
Sequence:CCGGTATCGGATAGCACGGACTTTACTCGAGTAAAGTCCGTGCTATCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-4144s21c1
Sequence:CCGGGGCAACTTATTCAGACTAAATCTCGAGATTTAGTCTGAATAAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-1477s21c1
Sequence:CCGGTGATCCAGGAGGGCCAATTAGCTCGAGCTAATTGGCCCTCCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029856.2-4314s21c1
Sequence:CCGGACAACTAAACGACCAGTAATTCTCGAGAATTACTGGTCGTTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029856
VALIDATED
ATAD5 MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029856.1-6206s1c1
Sequence:CCGGGCAGTCTCTAAAGTTACACAACTCGAGTTGTGTAACTTTAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029856.1-5712s1c1
Sequence:CCGGCGGAACATTTGTCGGACAGAACTCGAGTTCTGTCCGACAAATGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029856.1-4341s1c1
Sequence:CCGGCCCACATTTAGTCTAGTGTTTCTCGAGAAACACTAGACTAAATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-6693s21c1
Sequence:CCGGATGTCTTGTATCCTAGTATATCTCGAGATATACTAGGATACAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029856.2-3652s21c1
Sequence:CCGGTATCGGATAGCACGGACTTTACTCGAGTAAAGTCCGTGCTATCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-4144s21c1
Sequence:CCGGGGCAACTTATTCAGACTAAATCTCGAGATTTAGTCTGAATAAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029856.2-1477s21c1
Sequence:CCGGTGATCCAGGAGGGCCAATTAGCTCGAGCTAATTGGCCCTCCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029856.2-4314s21c1
Sequence:CCGGACAACTAAACGACCAGTAATTCTCGAGAATTACTGGTCGTTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024857
ATAD5 MISSION shRNA Bacterial Glycerol Stock
ATPase family, AAA domain containing 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-2101s1c1
Sequence:CCGGGCTAAATGTTTCCACGCCCAACTCGAGTTGGGCGTGGAAACATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-3533s1c1
Sequence:CCGGGCCAGTGAACTTATAGGAAATCTCGAGATTTCCTATAAGTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-4583s1c1
Sequence:CCGGGAACGACCATTAACCCTTTATCTCGAGATAAAGGGTTAATGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-2873s1c1
Sequence:CCGGCCAGATTTGTTGAAACGGCAACTCGAGTTGCCGTTTCAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-591s1c1
Sequence:CCGGGCAAGATAAAGTCACCTGAATCTCGAGATTCAGGTGACTTTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-5620s21c1
Sequence:CCGGTAGTCAGTCAGCAGCTAATTTCTCGAGAAATTAGCTGCTGACTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-4429s21c1
Sequence:CCGGTGTTGCCAGCTACCTACAAATCTCGAGATTTGTAGGTAGCTGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-2293s21c1
Sequence:CCGGTGATTCAGAGAGCCCTATTAGCTCGAGCTAATAGGGCTCTCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-5709s21c1
Sequence:CCGGGTAATAGACAAGCTAGTATAACTCGAGTTATACTAGCTTGTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024857
ATAD5 MISSION shRNA shRNA Plasmid DNA
ATPase family, AAA domain containing 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-2101s1c1
Sequence:CCGGGCTAAATGTTTCCACGCCCAACTCGAGTTGGGCGTGGAAACATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-3533s1c1
Sequence:CCGGGCCAGTGAACTTATAGGAAATCTCGAGATTTCCTATAAGTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-4583s1c1
Sequence:CCGGGAACGACCATTAACCCTTTATCTCGAGATAAAGGGTTAATGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-2873s1c1
Sequence:CCGGCCAGATTTGTTGAAACGGCAACTCGAGTTGCCGTTTCAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-591s1c1
Sequence:CCGGGCAAGATAAAGTCACCTGAATCTCGAGATTCAGGTGACTTTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-5620s21c1
Sequence:CCGGTAGTCAGTCAGCAGCTAATTTCTCGAGAAATTAGCTGCTGACTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-4429s21c1
Sequence:CCGGTGTTGCCAGCTACCTACAAATCTCGAGATTTGTAGGTAGCTGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-2293s21c1
Sequence:CCGGTGATTCAGAGAGCCCTATTAGCTCGAGCTAATAGGGCTCTCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-5709s21c1
Sequence:CCGGGTAATAGACAAGCTAGTATAACTCGAGTTATACTAGCTTGTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024857
ATAD5 MISSION shRNA Lentiviral Transduction Particles
ATPase family, AAA domain containing 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-2101s1c1
Sequence:CCGGGCTAAATGTTTCCACGCCCAACTCGAGTTGGGCGTGGAAACATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-3533s1c1
Sequence:CCGGGCCAGTGAACTTATAGGAAATCTCGAGATTTCCTATAAGTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-4583s1c1
Sequence:CCGGGAACGACCATTAACCCTTTATCTCGAGATAAAGGGTTAATGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-2873s1c1
Sequence:CCGGCCAGATTTGTTGAAACGGCAACTCGAGTTGCCGTTTCAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024857.3-591s1c1
Sequence:CCGGGCAAGATAAAGTCACCTGAATCTCGAGATTCAGGTGACTTTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-5620s21c1
Sequence:CCGGTAGTCAGTCAGCAGCTAATTTCTCGAGAAATTAGCTGCTGACTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-4429s21c1
Sequence:CCGGTGTTGCCAGCTACCTACAAATCTCGAGATTTGTAGGTAGCTGGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-2293s21c1
Sequence:CCGGTGATTCAGAGAGCCCTATTAGCTCGAGCTAATAGGGCTCTCTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024857.3-5709s21c1
Sequence:CCGGGTAATAGACAAGCTAGTATAACTCGAGTTATACTAGCTTGTCTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks